GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-06 11:32:14, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_001349367            1649 bp    mRNA    linear   PRI 02-AUG-2023
DEFINITION  Homo sapiens centromere protein K (CENPK), transcript variant 3,
            mRNA.
ACCESSION   NM_001349367 XM_011543534
VERSION     NM_001349367.2
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1649)
  AUTHORS   Li X, Han YR, Xuefeng X, Ma YX, Xing GS, Yang ZW, Zhang Z, Shi L
            and Wu XL.
  TITLE     Lentivirus-mediated short hairpin RNA interference of CENPK
            inhibits growth of colorectal cancer cells with overexpression of
            Cullin 4A
  JOURNAL   World J Gastroenterol 28 (37), 5420-5443 (2022)
   PUBMED   36312839
  REMARK    GeneRIF: Lentivirus-mediated short hairpin RNA interference of
            CENPK inhibits growth of colorectal cancer cells with
            overexpression of Cullin 4A.
REFERENCE   2  (bases 1 to 1649)
  AUTHORS   Tian T, Chen L, Dou Z, Yang Z, Gao X, Yuan X, Wang C, Liu R, Shen
            Z, Gui P, Teng M, Meng X, Hill DL, Li L, Zhang X, Liu X, Sun L,
            Zang J and Yao X.
  TITLE     Structural insights into human CCAN complex assembled onto DNA
  JOURNAL   Cell Discov 8 (1), 90 (2022)
   PUBMED   36085283
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1649)
  AUTHORS   Tian H, Wang F, Deng Y, Ying L, Fang W, Chen D, Miao C, Li H, Sun
            S, Ma Y, Cai H and Guo T.
  TITLE     Centromeric protein K (CENPK) promotes gastric cancer proliferation
            and migration via interacting with XRCC5
  JOURNAL   Gastric Cancer 25 (5), 879-895 (2022)
   PUBMED   35715658
  REMARK    GeneRIF: Centromeric protein K (CENPK) promotes gastric cancer
            proliferation and migration via interacting with XRCC5.
REFERENCE   4  (bases 1 to 1649)
  AUTHORS   Lin X, Wang F, Chen J, Liu J, Lin YB, Li L, Chen CB and Xu Q.
  TITLE     N6-methyladenosine modification of CENPK mRNA by ZC3H13 promotes
            cervical cancer stemness and chemoresistance
  JOURNAL   Mil Med Res 9 (1), 19 (2022)
   PUBMED   35418160
  REMARK    GeneRIF: N(6)-methyladenosine modification of CENPK mRNA by ZC3H13
            promotes cervical cancer stemness and chemoresistance.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1649)
  AUTHORS   Li Q, Liang J, Zhang S, An N, Xu L and Ye C.
  TITLE     Overexpression of centromere protein K (CENPK) gene in
            Differentiated Thyroid Carcinoma promote cell Proliferation and
            Migration
  JOURNAL   Bioengineered 12 (1), 1299-1310 (2021)
   PUBMED   33904381
  REMARK    GeneRIF: Overexpression of centromere protein K (CENPK) gene in
            Differentiated Thyroid Carcinoma promote cell Proliferation and
            Migration.
REFERENCE   6  (bases 1 to 1649)
  AUTHORS   Okada M, Cheeseman IM, Hori T, Okawa K, McLeod IX, Yates JR 3rd,
            Desai A and Fukagawa T.
  TITLE     The CENP-H-I complex is required for the efficient incorporation of
            newly synthesized CENP-A into centromeres
  JOURNAL   Nat Cell Biol 8 (5), 446-457 (2006)
   PUBMED   16622420
REFERENCE   7  (bases 1 to 1649)
  AUTHORS   Foltz DR, Jansen LE, Black BE, Bailey AO, Yates JR 3rd and
            Cleveland DW.
  TITLE     The human CENP-A centromeric nucleosome-associated complex
  JOURNAL   Nat Cell Biol 8 (5), 458-469 (2006)
   PUBMED   16622419
REFERENCE   8  (bases 1 to 1649)
  AUTHORS   Obuse C, Yang H, Nozaki N, Goto S, Okazaki T and Yoda K.
  TITLE     Proteomics analysis of the centromere complex from HeLa interphase
            cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of
            the CEN-complex, while BMI-1 is transiently co-localized with the
            centromeric region in interphase
  JOURNAL   Genes Cells 9 (2), 105-120 (2004)
   PUBMED   15009096
REFERENCE   9  (bases 1 to 1649)
  AUTHORS   Yamashita A, Ito M, Takamatsu N and Shiba T.
  TITLE     Characterization of Solt, a novel SoxLZ/Sox6 binding protein
            expressed in adult mouse testis
  JOURNAL   FEBS Lett 481 (2), 147-151 (2000)
   PUBMED   10996314
REFERENCE   10 (bases 1 to 1649)
  AUTHORS   Taki T, Hayashi Y, Taniwaki M, Seto M, Ueda R, Hanada R, Suzukawa
            K, Yokota J and Morishita K.
  TITLE     Fusion of the MLL gene with two different genes, AF-6 and
            AF-5alpha, by a complex translocation involving chromosomes 5, 6, 8
            and 11 in infant leukemia
  JOURNAL   Oncogene 13 (10), 2121-2130 (1996)
   PUBMED   8950979
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BG502832.1, BC005400.1, BG527280.1 and BC008504.1.
            
            On May 31, 2019 this sequence version replaced NM_001349367.1.
            
            Summary: CENPK is a subunit of a CENPH (MIM 605607)-CENPI (MIM
            300065)-associated centromeric complex that targets CENPA (MIM
            117139) to centromeres and is required for proper kinetochore
            function and mitotic progression (Okada et al., 2006 [PubMed
            16622420]).[supplied by OMIM, Mar 2008].
            
            Transcript Variant: This variant (3) differs in the 5' UTR and uses
            an alternate splice site in its 5' coding region, resulting in use
            of an alternate start codon, compared to variant 1. The encoded
            isoform (3) has a slightly longer, but distinct N-terminus compared
            to isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: DRR138522.1352282.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA1965299,
                                           SAMEA1966682 [ECO:0006172]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-56                BG502832.1         2-57
            57-123              BC005400.1         47-113
            124-454             BG527280.1         123-453
            455-1046            BC005400.1         493-1084
            1047-1649           BC008504.1         1129-1731
FEATURES             Location/Qualifiers
     source          1..1649
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5q12.3"
     gene            1..1649
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="centromere protein K"
                     /db_xref="GeneID:64105"
                     /db_xref="HGNC:HGNC:29479"
                     /db_xref="MIM:611502"
     exon            1..71
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1359976795"
     variation       2
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313487734"
     variation       3
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1752349587"
     variation       6
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1752348893"
     variation       7
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1752348579"
     variation       8
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306504051"
     variation       9
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1342831242"
     variation       11..20
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ggggctggca"
                     /replace="ggggctggcaggggctggca"
                     /db_xref="dbSNP:1485277906"
     variation       11
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1752347563"
     variation       12
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231982437"
     variation       13
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1028359789"
     variation       14
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:542352928"
     variation       15
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210224911"
     variation       19
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265798087"
     variation       21
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1752345149"
     variation       22..25
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="gc"
                     /replace="gcgc"
                     /db_xref="dbSNP:1257636747"
     variation       24
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1226707165"
     variation       28
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1752344063"
     variation       29
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1752343711"
     variation       30
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748792667"
     variation       31
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1422047918"
     variation       32
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1412446096"
     variation       33
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473419782"
     variation       34
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2150581284"
     variation       35
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1752342051"
     variation       36
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1343690787"
     variation       37
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140804671"
     variation       39
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553552680"
     variation       40
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1752340528"
     variation       41
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:9791024"
     variation       42
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404435189"
     variation       45
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1413477558"
     variation       46
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1011178654"
     variation       48
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:892736211"
     variation       49
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293152372"
     variation       50
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1752337962"
     variation       52
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1004353263"
     variation       53
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364825946"
     variation       55
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1752336831"
     variation       56
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41268429"
     misc_feature    59..61
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="upstream in-frame stop codon"
     variation       61
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1027093258"
     variation       62
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1003673595"
     variation       63
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995243929"
     variation       64
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558001621"
     variation       69
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1368732818"
     variation       71
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1157875168"
     exon            72..139
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       72
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548499564"
     variation       75..77
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tag"
                     /replace="tagttag"
                     /db_xref="dbSNP:1038778849"
     variation       77
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757254302"
     variation       84
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1751964644"
     variation       85
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225478568"
     variation       86
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1375448951"
     variation       90
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1751963569"
     variation       93
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1001509723"
     variation       94
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1445804221"
     variation       99
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171663462"
     variation       101
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1581126138"
     variation       103
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1374448596"
     variation       104
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906122153"
     variation       107
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:902390139"
     variation       114
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470058908"
     variation       115
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1751960081"
     variation       119
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1581126047"
     CDS             125..940
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="isoform 3 is encoded by transcript variant 3;
                     leucine zipper protein FKSG14; SoxLZ/Sox6-binding protein
                     Solt; protein AF-5alpha; interphase centromere complex
                     protein 37"
                     /codon_start=1
                     /product="centromere protein K isoform 3"
                     /protein_id="NP_001336296.1"
                     /db_xref="GeneID:64105"
                     /db_xref="HGNC:HGNC:29479"
                     /db_xref="MIM:611502"
                     /translation="
MTLFQEDLDPDSTTDVGDVTNTEEELIRECEEMWKDMEECQNKLSLIGTETLTDSNAQLSLLIMQVKCLTAELSQWQKKTPETIPLTEDVLITLGKEEFQKLRQDLEMVLSTKESKNEKLKEDLEREQRWLDEQQQIMESLNVLHSELKNKVETFSESRIFNELKTKMLNIKEYKEKLLSTLGEFLEDHFPLPDRSVKKKKKNIQESSVNLITLHEMLEILINRLFDVPHDPYVKISDSFWPPYVELLLRNGIALRHPEDPTRIRLEAFHQ"
     misc_feature    158..937
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="Centromere-associated protein K; Region: CENP-K;
                     pfam11802"
                     /db_xref="CDD:432085"
     variation       127
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2150571791"
     variation       129
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358207757"
     variation       130
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173365559"
     variation       131
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1751958616"
     variation       133
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330586449"
     variation       134
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1337771016"
     variation       135
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401876701"
     variation       137
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1440214129"
     exon            140..241
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       141
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757460492"
     variation       143
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777895549"
     variation       147
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2096371242"
     variation       149
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:935938524"
     variation       152
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2150532568"
     variation       153
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758896315"
     variation       154
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75497175"
     variation       156
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1216026136"
     variation       159
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371070860"
     variation       166
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1750726023"
     variation       167
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760004670"
     variation       168
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750725249"
     variation       176
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1397513933"
     variation       177
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750724525"
     variation       178
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754218341"
     variation       179
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766178671"
     variation       183
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760347848"
     variation       185
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1348543974"
     variation       188..192
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="actga"
                     /db_xref="dbSNP:1429400174"
     variation       190
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772652364"
     variation       191..199
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="gaagaa"
                     /replace="gaagaagaa"
                     /db_xref="dbSNP:1347528124"
     variation       196
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423115596"
     variation       197
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1750721303"
     variation       200
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150574725"
     variation       202
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201745679"
     variation       204
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481438294"
     variation       205
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774283954"
     variation       206
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141729484"
     variation       209
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206680426"
     variation       213
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1581093357"
     variation       219..221
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1437145639"
     variation       219
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1248409774"
     variation       220
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750716760"
     variation       222
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749111718"
     variation       226
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1750714903"
     variation       227
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263513424"
     variation       230
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775244207"
     variation       233
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771118232"
     variation       234
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747252575"
     variation       239
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868732343"
     exon            242..298
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       242
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750271640"
     variation       243
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:543487501"
     variation       244
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043343369"
     variation       245
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750268417"
     variation       256
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448020199"
     variation       257
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762865136"
     variation       260
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775330841"
     variation       262
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:148016416"
     variation       263
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750263924"
     variation       264..266
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="ttg"
                     /db_xref="dbSNP:779227890"
     variation       264
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454849271"
     variation       266
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144481454"
     variation       267
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150519689"
     variation       269
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745593902"
     variation       274..285
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aacactcaccga"
                     /db_xref="dbSNP:1242902542"
     variation       276..282
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="cac"
                     /replace="cactcac"
                     /db_xref="dbSNP:757802386"
     variation       276
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:946304876"
     variation       278
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138527872"
     variation       280
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339735347"
     variation       282
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2150519582"
     variation       283
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757907403"
     variation       284
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141548635"
     variation       288
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201709067"
     variation       295
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755596314"
     variation       296
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764377925"
     exon            299..371
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       300
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749320661"
     variation       301
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780631678"
     variation       305..309
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tt"
                     /replace="ttgtt"
                     /db_xref="dbSNP:1750067937"
     variation       305
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1750068401"
     variation       313
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750067487"
     variation       315
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:532263854"
     variation       316
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1328421596"
     variation       317
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1750066060"
     variation       319
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1750065565"
     variation       320
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278922834"
     variation       325
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746283375"
     variation       328..330
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1388017290"
     variation       334
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781388497"
     variation       335
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751218204"
     variation       336
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406983239"
     variation       341
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391243960"
     variation       342..348
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tca"
                     /replace="tcagtca"
                     /db_xref="dbSNP:762598205"
     variation       342
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561685621"
     variation       343
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777349763"
     variation       344
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185445391"
     variation       345
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1425260470"
     variation       349
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749780402"
     variation       350
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750057694"
     variation       352
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477188242"
     variation       353
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1750056781"
     variation       355
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750056286"
     variation       356..362
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:750256768"
     variation       358
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377608156"
     variation       362
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:549718297"
     variation       363
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750053838"
     variation       364
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759373577"
     variation       365
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753728671"
     variation       368
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1561685364"
     variation       371
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1693238677"
     exon            372..418
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       374
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438182467"
     variation       377
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:557986609"
     variation       379
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764452510"
     variation       381
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763064949"
     variation       382
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1483041739"
     variation       383
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1748212552"
     variation       386
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1748212077"
     variation       387..388
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:1403653612"
     variation       391
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765236390"
     variation       392
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548653305"
     variation       394
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771385648"
     variation       395
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1286587676"
     variation       397
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138507676"
     variation       401
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314951065"
     variation       402
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974580309"
     variation       405
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773540586"
     variation       407..408
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1581021207"
     variation       408
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2150453321"
     variation       412
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1581021175"
     variation       414..415
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:779363914"
     variation       414..415
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1748205064"
     variation       415
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228585329"
     exon            419..501
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       421
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1393117032"
     variation       424
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180206825"
     variation       430
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150375703"
     variation       434
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773628734"
     variation       438
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237140365"
     variation       447
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1232231851"
     variation       449
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193606113"
     variation       450
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1745284481"
     variation       451
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547550705"
     variation       452
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1745283514"
     variation       454
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1186908669"
     variation       458
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:748490924"
     variation       459
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773901255"
     variation       462
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2150375557"
     variation       468
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768317556"
     variation       469
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1561634678"
     variation       471
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:748850005"
     variation       474
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745280061"
     variation       475
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145897680"
     variation       476
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753691260"
     variation       481
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376463567"
     variation       482
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1327050486"
     variation       484..487
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="aaag"
                     /db_xref="dbSNP:2150375437"
     variation       489
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140748564"
     variation       491
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1286143770"
     variation       492
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1745276214"
     variation       493
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745797201"
     variation       494
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302333711"
     variation       496
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434037126"
     variation       498
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1580930674"
     variation       499
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:909927578"
     exon            502..600
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       504
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745248317"
     variation       505
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195109001"
     variation       506
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1745247359"
     variation       508
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185309293"
     variation       509
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755218264"
     variation       510
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138940796"
     variation       515
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1745244701"
     variation       517
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357350104"
     variation       518
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1265044045"
     variation       519
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:892129867"
     variation       520
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1561633837"
     variation       521
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867891240"
     variation       521
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1745242213"
     variation       522
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:780195488"
     variation       523..554
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ac"
                     /replace="acagcaacagataatggaatctcttaatgtac"
                     /db_xref="dbSNP:1745237533"
     variation       529
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157077028"
     variation       532
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363410017"
     variation       541
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756212865"
     variation       544
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750466231"
     variation       548
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325715984"
     variation       551
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767952170"
     variation       553
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406824741"
     variation       554
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1580929057"
     variation       556
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150254661"
     variation       558
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451415236"
     variation       559
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1745235605"
     variation       560
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1580928949"
     variation       561..562
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:749771436"
     variation       561
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751927567"
     variation       562
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141033147"
     variation       567
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775303734"
     variation       568
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1471995857"
     variation       574
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425234534"
     variation       576
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323742457"
     variation       578
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745230797"
     variation       582
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:540839130"
     variation       583
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745229775"
     variation       586
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745229292"
     variation       587
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1475383930"
     variation       591
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1240814809"
     variation       592
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1201507225"
     variation       593
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452590609"
     variation       597
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199710596"
     variation       598
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776182305"
     variation       599
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770828450"
     exon            601..727
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       604
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745162523"
     variation       607
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192069105"
     variation       620
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745161624"
     variation       623..626
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1238965408"
     variation       625
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745161152"
     variation       626
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752112029"
     variation       630
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1203948509"
     variation       632
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150372287"
     variation       635
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745159363"
     variation       638
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745158892"
     variation       641
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764451391"
     variation       642
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758865586"
     variation       643
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753079695"
     variation       647
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765028924"
     variation       649
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376864120"
     variation       658
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745154105"
     variation       661..663
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="gag"
                     /db_xref="dbSNP:1231746887"
     variation       661
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216777810"
     variation       662
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745152720"
     variation       666
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378696125"
     variation       673
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538146502"
     variation       674
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868259372"
     variation       676
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745150168"
     variation       679
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1745149712"
     variation       680
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765914401"
     variation       681
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185768219"
     variation       684
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569355500"
     variation       685
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377239133"
     variation       686
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773227049"
     variation       688
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1745146291"
     variation       689
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745145818"
     variation       691
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172188810"
     variation       695
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866918568"
     variation       696
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771962047"
     variation       698
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774114264"
     variation       700
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176885832"
     variation       701
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468783521"
     variation       706
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770061194"
     variation       708
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:151068525"
     variation       711
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781204320"
     variation       712
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759021447"
     variation       716..720
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1284629517"
     variation       718
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745140405"
     variation       722..726
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaa"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1745137975"
     variation       722
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757372616"
     variation       727
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409007703"
     exon            728..781
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       728
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213991862"
     variation       729..739
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aa"
                     /replace="aaaacattcaa"
                     /db_xref="dbSNP:1743744485"
     variation       732
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774200181"
     variation       734
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1270744844"
     variation       735
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1561615890"
     variation       737
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219885542"
     variation       741
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308635150"
     variation       747
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759382373"
     variation       758
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776934831"
     variation       759
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1580880398"
     variation       763
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376455824"
     variation       766
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743741013"
     variation       768
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747162578"
     variation       773
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743739935"
     variation       775
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1440453004"
     variation       781
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777984796"
     exon            782..1649
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       783
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193515151"
     variation       784
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457022289"
     variation       787
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407171241"
     variation       788..794
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ata"
                     /replace="ataaata"
                     /db_xref="dbSNP:1410263007"
     variation       788
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1484537441"
     variation       789
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779591294"
     variation       791..794
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aata"
                     /db_xref="dbSNP:774484343"
     variation       792
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210752666"
     variation       794
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346222240"
     variation       795..798
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="gatt"
                     /db_xref="dbSNP:1240110785"
     variation       800..802
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1161999795"
     variation       800
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1322275300"
     variation       804
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335325956"
     variation       806
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769017086"
     variation       811
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749715663"
     variation       812
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755866468"
     variation       813..824
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="atg"
                     /replace="atgatccatatg"
                     /db_xref="dbSNP:1329394537"
     variation       813..814
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="at"
                     /replace="ataat"
                     /db_xref="dbSNP:1373474133"
     variation       813
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542463893"
     variation       814
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145412104"
     variation       815..816
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="tttttt"
                     /db_xref="dbSNP:771313026"
     variation       818
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:960235172"
     variation       819
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454009624"
     variation       820
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362811635"
     variation       823
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1580864222"
     variation       824
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743131833"
     variation       827..830
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1743131212"
     variation       832
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756782808"
     variation       834
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368786771"
     variation       836
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1257572242"
     variation       844
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:919152018"
     variation       846
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489193688"
     variation       847
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1034387973"
     variation       848..849
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:749720138"
     variation       849
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1484974307"
     variation       850
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112503088"
     variation       852
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001989973"
     variation       853
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:899250076"
     variation       856
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762786158"
     variation       866
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1016654387"
     variation       868
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141551708"
     variation       870
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206028496"
     variation       872
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752602369"
     variation       873
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147863579"
     variation       874
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1004913643"
     variation       875
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207772442"
     variation       876
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759344010"
     variation       877
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161689071"
     variation       878
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743117164"
     variation       881
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1386097326"
     variation       886
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:528929654"
     variation       887..888
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1580863575"
     variation       890
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743115124"
     variation       892
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1001577205"
     variation       894
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334649862"
     variation       900
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773588233"
     variation       902
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772376049"
     variation       903
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414102882"
     variation       905
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1350727271"
     variation       909
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762026997"
     variation       911
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774554899"
     variation       912
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749758005"
     variation       914
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746284263"
     variation       916
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775999649"
     variation       918
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375568861"
     variation       920
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746181867"
     variation       924
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163495587"
     variation       926
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228791496"
     variation       927
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:933805256"
     variation       928
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1279834410"
     variation       931
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1487486189"
     variation       933
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1244285837"
     variation       937
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:36068055"
     variation       943
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756880796"
     variation       948..951
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1743101471"
     variation       953
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1260071196"
     variation       954
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746580111"
     variation       955
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1469027129"
     variation       956
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:777142009"
     variation       958
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757857332"
     variation       959
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1472961778"
     variation       960
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748983371"
     variation       962
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:942422849"
     variation       963
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752587413"
     variation       967..971
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1410026237"
     variation       967
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765169647"
     variation       968
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743095898"
     variation       972
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554102945"
     variation       973
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743094716"
     variation       974
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754847602"
     variation       975
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753650693"
     variation       978
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149505574"
     variation       979
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1172922491"
     variation       980
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394689518"
     variation       988
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762116904"
     variation       989..992
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="t"
                     /replace="tatt"
                     /db_xref="dbSNP:1743090541"
     variation       989
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459452062"
     variation       990
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774559990"
     variation       991
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743091117"
     variation       1003
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1649200052"
     variation       1004
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743090066"
     variation       1006
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329637299"
     variation       1008
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904709766"
     variation       1012
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743088868"
     variation       1015
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1039179836"
     variation       1016
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2150328447"
     variation       1017
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1312201262"
     variation       1020..1022
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:1561607792"
     variation       1021..1023
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="cat"
                     /db_xref="dbSNP:1743086947"
     variation       1026
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743086428"
     variation       1029
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743085588"
     variation       1033
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743084567"
     variation       1034
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1370569166"
     variation       1037
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743083080"
     variation       1039
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1743082614"
     variation       1040
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978818163"
     variation       1041
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:577792004"
     variation       1042
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349464377"
     variation       1043
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:945753719"
     variation       1044
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:913482577"
     variation       1047..1053
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="gccatct"
                     /db_xref="dbSNP:3050538"
     variation       1047..1053
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="gccatct"
                     /replace="gccatctgccatct"
                     /db_xref="dbSNP:2150328214"
     variation       1047
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1580862389"
     variation       1051..1054
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="t"
                     /replace="tctt"
                     /db_xref="dbSNP:764130293"
     variation       1052..1058
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ctt"
                     /replace="cttactt"
                     /db_xref="dbSNP:750310884"
     variation       1052
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:993073629"
     variation       1053
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199686668"
     variation       1055
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:960287476"
     variation       1056
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557852862"
     variation       1061
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150328136"
     variation       1066
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217910725"
     variation       1067
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11952932"
     variation       1071
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743074804"
     variation       1072
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1207342510"
     variation       1074
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051477604"
     variation       1079
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980313749"
     variation       1081
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379083883"
     variation       1083
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743072067"
     variation       1084
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771152778"
     variation       1086
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1476923760"
     variation       1088
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963780201"
     variation       1102
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1172842501"
     variation       1104
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743069976"
     variation       1110
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743069574"
     variation       1112
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743069146"
     variation       1113
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743068751"
     variation       1121
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1016373653"
     variation       1135
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743067853"
     variation       1139
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743067391"
     variation       1140
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743066970"
     variation       1144
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743066553"
     variation       1145
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743066123"
     variation       1147
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377015673"
     variation       1148
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743065238"
     variation       1149
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1431598611"
     variation       1150
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476832769"
     variation       1161
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743063753"
     variation       1162
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743063346"
     variation       1165
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743062908"
     variation       1167
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743062518"
     variation       1181
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005290916"
     variation       1184
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743061710"
     variation       1187
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743061305"
     variation       1191
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395176719"
     variation       1192..1193
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1743060475"
     variation       1194
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950730610"
     variation       1195
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918903214"
     variation       1199..1203
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="cttac"
                     /replace="cttacttac"
                     /db_xref="dbSNP:1743058362"
     variation       1201
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743059183"
     variation       1202
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1580861850"
     variation       1203
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743057940"
     variation       1204
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1030344060"
     variation       1207
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:998061561"
     variation       1210
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743056633"
     variation       1212
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743056190"
     variation       1215..1219
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tt"
                     /replace="ttctt"
                     /db_xref="dbSNP:1379062344"
     variation       1218
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743055799"
     variation       1225
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1232536793"
     variation       1226
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743054584"
     variation       1228
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:901106029"
     variation       1235..1237
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:2150327537"
     variation       1242
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1303180714"
     variation       1248
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743053398"
     variation       1252
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963227783"
     variation       1270
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039911851"
     variation       1271
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926467233"
     variation       1272
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743050692"
     variation       1274..1275
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1743050266"
     variation       1276
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1231285212"
     variation       1278
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743049462"
     variation       1280
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138007557"
     variation       1282
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743048540"
     variation       1283
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338827386"
     variation       1287
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1210597400"
     variation       1287
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743047305"
     variation       1289
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1743046847"
     variation       1290
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2150327342"
     variation       1292..1295
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1743045993"
     variation       1292
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1269715863"
     variation       1296
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260858610"
     variation       1302
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2150327288"
     variation       1306
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195775126"
     variation       1307
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:970156172"
     variation       1313
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2150327248"
     variation       1314
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743044194"
     variation       1324
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555421066"
     variation       1331
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743043231"
     variation       1332
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743042786"
     variation       1334
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743042345"
     variation       1336
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743041595"
     variation       1339
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1248470707"
     variation       1342
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:535728857"
     variation       1344
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743040225"
     variation       1345
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743039797"
     variation       1348
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743039346"
     variation       1354
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743038929"
     variation       1360
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743038506"
     variation       1365
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743038099"
     variation       1366..1369
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1743037214"
     variation       1367
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743037649"
     variation       1370..1371
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:1743036202"
     variation       1370
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181291384"
     variation       1373
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:956248428"
     variation       1374
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1457981299"
     variation       1375
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191377833"
     variation       1376..1380
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ta"
                     /replace="taata"
                     /db_xref="dbSNP:1743032082"
     variation       1376
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743033537"
     variation       1378
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539417576"
     variation       1382
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1164554935"
     variation       1384
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743030703"
     variation       1386
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042853202"
     variation       1389
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199984915"
     variation       1400
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1388092390"
     variation       1406
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743028067"
     variation       1410
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1343109599"
     variation       1411
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1031647042"
     variation       1412
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1437815344"
     variation       1413
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743024787"
     variation       1416
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743024219"
     variation       1418
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743023557"
     variation       1419
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294075340"
     variation       1425
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:945709709"
     variation       1427
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150326827"
     variation       1428
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743021901"
     variation       1429
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326412701"
     variation       1431
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743021208"
     variation       1434
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1000450375"
     variation       1435..1436
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:1743019563"
     variation       1437
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374187039"
     variation       1444
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1743018191"
     variation       1450
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743017506"
     variation       1451
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1354485971"
     variation       1452
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056728221"
     variation       1458
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743016253"
     variation       1459
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1213331032"
     variation       1464
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268486647"
     variation       1475
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743014908"
     variation       1477..1478
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1743014111"
     variation       1477
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743014523"
     variation       1478
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1039250611"
     variation       1479
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743013272"
     variation       1483
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743012845"
     variation       1491
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186533991"
     variation       1495
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743011987"
     variation       1498
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743011557"
     variation       1502..1505
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:1743010647"
     variation       1502
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1340299966"
     variation       1505
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743010222"
     variation       1510
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424395658"
     variation       1511
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532743192"
     variation       1512..1519
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tatta"
                     /replace="tattatta"
                     /db_xref="dbSNP:1743008574"
     variation       1513
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1366225240"
     variation       1518..1522
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ta"
                     /replace="taata"
                     /db_xref="dbSNP:1159449444"
     variation       1519
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1460556343"
     variation       1522..1528
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="at"
                     /replace="atatcat"
                     /db_xref="dbSNP:1459141015"
     variation       1523
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1389766148"
     variation       1524
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743006871"
     variation       1527
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743006467"
     variation       1531
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927562539"
     variation       1532
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2150326376"
     variation       1533
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743005152"
     variation       1534
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743004554"
     variation       1537
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1287552641"
     variation       1539
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361828535"
     variation       1541
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980658237"
     variation       1545
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314885435"
     variation       1546
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743001315"
     variation       1550
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743000469"
     variation       1555
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1353680059"
     variation       1558
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1327594781"
     variation       1559
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051966282"
     variation       1564
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289235686"
     variation       1565..1571
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="atta"
                     /replace="attatta"
                     /db_xref="dbSNP:1331567359"
     variation       1568
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1742997647"
     variation       1570
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1742996975"
     variation       1572
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1742995591"
     variation       1575
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1742994796"
     variation       1576
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:929048520"
     variation       1578
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369693784"
     variation       1596
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259977140"
     variation       1603
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1483507690"
     variation       1604
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1202138533"
     variation       1605
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1742990821"
     variation       1609..1612
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:897488737"
     variation       1617
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176718170"
     variation       1623..1631
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaat"
                     /replace="aaataaaat"
                     /db_xref="dbSNP:1421192369"
     regulatory      1624..1629
                     /regulatory_class="polyA_signal_sequence"
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="hexamer: AATAAA"
     variation       1625
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1464857841"
     variation       1630..1635
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="att"
                     /replace="attatt"
                     /db_xref="dbSNP:1580860318"
     variation       1638
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1742987371"
     variation       1639
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1742986932"
     variation       1646
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:879097828"
     variation       1647
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1182336846"
     polyA_site      1649
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="major polyA site"
ORIGIN      
gcagaagtccggggctggcaagcgcttcctgcgcagcgcctaggcgacctggagtttgtgacgctgtgatggtctagaggctggagattcaagatctgggtgccatcattttctggttctgttgatgaccctcttccaggaggatctagatccggatagtactacagatgtgggagatgttacaaatactgaagaagaacttattagagaatgtgaagaaatgtggaaagatatggaagaatgtcagaataaattatcacttattggaactgaaacactcaccgattcaaatgctcagctatcattgttaattatgcaagtaaaatgtttaaccgctgaactcagtcaatggcagaaaaaaacacctgaaacaattcccttgactgaagacgttctcataacattaggaaaagaagagttccaaaagctgagacaagatcttgaaatggtactgtccactaaggagtcaaagaatgaaaagttaaaggaagacttagaaagggaacaacggtggttggatgaacagcaacagataatggaatctcttaatgtactacacagtgaattgaaaaataaggttgaaacattttctgaatcaagaatctttaatgaactgaaaactaaaatgcttaatataaaagaatataaggagaaactcttgagtaccttgggcgagtttctagaagaccattttcctctgcctgatagaagtgttaaaaagaaaaagaaaaacattcaagaatcatctgtaaacctgataacactgcatgaaatgttagagattcttataaatagattatttgatgttccacatgatccatatgtcaaaattagtgattccttttggccaccttatgttgagctgctgctgcgtaatggaattgccttgagacatccagaagatccaacccgaataagattagaagctttccatcagtaaaaggatgttttcttttttcacacagtaaaaattcttatcattcaaggatattggaaccacaggactatttggataaaaaacattatttgcaaattaatgcgcataggccatcttacttttattgcaaaatggcatgtgctgccatctattattcatttttaaatggtcatttcttattcagtgagtgctttagtgttttaaactatatggataagaatgcaggtagataatattctaggcataaaacatttaatgtaccttacctcatgcaatattctttggattctttgttgatttatgatattgctaatataatattttcttaaaatatataacaatatcttttatgcattttgagttccagctggtgcttctttatatttagaaattataatgggaaggtcatttaatttacagatggttttaaaattgaggtaatatctgaggtggcataatttaaaaatatttagcaaatttgtttcatatatactgtcttatttctagatttgtttaaaattggaatatgaaaaactaatggataaagctagcataaaattgatattttagtttgtattattaatatatcatgttaccttatatattaatctactcttgattctgctaattattaccaacaaaattgtattcatgacattttattaatcctctgtgaattttctgtaaataaaattatttctgaaaatctcta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]