GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-04 11:06:29, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_001317122           13712 bp    mRNA    linear   PRI 29-MAY-2023
DEFINITION  Homo sapiens argonaute RISC component 1 (AGO1), transcript variant
            1, mRNA.
ACCESSION   NM_001317122
VERSION     NM_001317122.2
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 13712)
  AUTHORS   Fang X, Ren LH, Shrestha SM, Ji Q, Xu Z, Wang D, Ding Q, Liang X
            and Shi RH.
  TITLE     LINC01116 modulates EMT process via binding with AGO1 mRNA in
            oesophageal squamous cell carcinoma
  JOURNAL   Biochim Biophys Acta Mol Cell Res 1870 (5), 119447 (2023)
   PUBMED   36990227
  REMARK    GeneRIF: LINC01116 modulates EMT process via binding with AGO1 mRNA
            in oesophageal squamous cell carcinoma.
REFERENCE   2  (bases 1 to 13712)
  AUTHORS   Schalk A, Cousin MA, Dsouza NR, Challman TD, Wain KE, Powis Z,
            Minks K, Trimouille A, Lasseaux E, Lacombe D, Angelini C, Michaud
            V, Van-Gils J, Spataro N, Ruiz A, Gabau E, Stolerman E, Washington
            C, Louie R, Lanpher BC, Kemppainen JL, Innes M, Kooy F, Meuwissen
            M, Goldenberg A, Lecoquierre F, Vera G, Diderich KEM, Sheidley B,
            El Achkar CM, Park M, Hamdan FF, Michaud JL, Lewis AJ, Zweier C,
            Reis A, Wagner M, Weigand H, Journel H, Keren B, Passemard S,
            Mignot C, van Gassen K, Brilstra EH, Itzikowitz G, O'Heir E, Allen
            J, Donald KA, Korf BR, Skelton T, Thompson M, Robin NH, Rudy NL,
            Dobyns WB, Foss K, Zarate YA, Bosanko KA, Alembik Y, Durand B, Tran
            Mau-Them F, Ranza E, Blanc X, Antonarakis SE, McWalter K, Torti E,
            Millan F, Dameron A, Tokita M, Zimmermann MT, Klee EW, Piton A and
            Gerard B.
  TITLE     De novo coding variants in the AGO1 gene cause a neurodevelopmental
            disorder with intellectual disability
  JOURNAL   J Med Genet 59 (10), 965-975 (2022)
   PUBMED   34930816
  REMARK    GeneRIF: De novo coding variants in the AGO1 gene cause a
            neurodevelopmental disorder with intellectual disability.
REFERENCE   3  (bases 1 to 13712)
  AUTHORS   Kowalczyk M, Kowalczyk E, Galita G, Majsterek I, Talarowska M,
            Poplawski T, Kwiatkowski P, Lichota A and Sienkiewicz M.
  TITLE     Association of Polymorphic Variants in Argonaute Genes with
            Depression Risk in a Polish Population
  JOURNAL   Int J Mol Sci 23 (18), 10586 (2022)
   PUBMED   36142498
  REMARK    GeneRIF: Association of Polymorphic Variants in Argonaute Genes
            with Depression Risk in a Polish Population.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 13712)
  AUTHORS   Niu Y, Qian Q, Li J, Gong P, Jiao X, Mao X, Xiao B, Long L and Yang
            Z.
  TITLE     De novo variants in AGO1 recapitulate a heterogeneous
            neurodevelopmental disorder phenotype
  JOURNAL   Clin Genet 101 (4), 459-465 (2022)
   PUBMED   35060114
  REMARK    GeneRIF: De novo variants in AGO1 recapitulate a heterogeneous
            neurodevelopmental disorder phenotype.
REFERENCE   5  (bases 1 to 13712)
  AUTHORS   Eswarappa SM, Potdar AA, Koch WJ, Fan Y, Vasu K, Lindner D, Willard
            B, Graham LM, DiCorleto PE and Fox PL.
  TITLE     Programmed translational readthrough generates antiangiogenic
            VEGF-Ax
  JOURNAL   Cell 157 (7), 1605-1618 (2014)
   PUBMED   24949972
REFERENCE   6  (bases 1 to 13712)
  AUTHORS   Carmell MA, Xuan Z, Zhang MQ and Hannon GJ.
  TITLE     The Argonaute family: tentacles that reach into RNAi, developmental
            control, stem cell maintenance, and tumorigenesis
  JOURNAL   Genes Dev 16 (21), 2733-2742 (2002)
   PUBMED   12414724
  REMARK    Review article
REFERENCE   7  (bases 1 to 13712)
  AUTHORS   Martinez J, Patkaniowska A, Urlaub H, Luhrmann R and Tuschl T.
  TITLE     Single-stranded antisense siRNAs guide target RNA cleavage in RNAi
  JOURNAL   Cell 110 (5), 563-574 (2002)
   PUBMED   12230974
REFERENCE   8  (bases 1 to 13712)
  AUTHORS   Beier H and Grimm M.
  TITLE     Misreading of termination codons in eukaryotes by natural nonsense
            suppressor tRNAs
  JOURNAL   Nucleic Acids Res 29 (23), 4767-4782 (2001)
   PUBMED   11726686
  REMARK    Review article
REFERENCE   9  (bases 1 to 13712)
  AUTHORS   Koesters R, Adams V, Betts D, Moos R, Schmid M, Siermann A, Hassam
            S, Weitz S, Lichter P, Heitz PU, von Knebel Doeberitz M and Briner
            J.
  TITLE     Human eukaryotic initiation factor EIF2C1 gene: cDNA sequence,
            genomic organization, localization to chromosomal bands 1p34-p35,
            and expression
  JOURNAL   Genomics 61 (2), 210-218 (1999)
   PUBMED   10534406
REFERENCE   10 (bases 1 to 13712)
  AUTHORS   Reddy PH, Stockburger E, Gillevet P and Tagle DA.
  TITLE     Mapping and characterization of novel (CAG)n repeat cDNAs from
            adult human brain derived by the oligo capture method
  JOURNAL   Genomics 46 (2), 174-182 (1997)
   PUBMED   9417904
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from HY052874.1, BC063275.1,
            AK314148.1, AF093097.1, CR936823.1 and AL139286.13.
            
            On Aug 13, 2020 this sequence version replaced NM_001317122.1.
            
            Summary: This gene encodes a member of the argonaute family of
            proteins, which associate with small RNAs and have important roles
            in RNA interference (RNAi) and RNA silencing. This protein binds to
            microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses
            translation of mRNAs that are complementary to them. It is also
            involved in transcriptional gene silencing (TGS) of promoter
            regions that are complementary to bound short antigene RNAs
            (agRNAs), as well as in the degradation of miRNA-bound mRNA
            targets. Alternatively spliced transcript variants encoding
            different isoforms have been found for this gene. A recent study
            showed this gene to be an authentic stop codon readthrough target,
            and that its mRNA could give rise to an additional C-terminally
            extended isoform by use of an alternative in-frame translation
            termination codon. [provided by RefSeq, Nov 2015].
            
            Transcript Variant: Transcript Variant: This variant (1) represents
            the predominant transcript and encodes two isoforms, which result
            from the use of alternative in-frame translation termination
            codons. The shorter isoform (1) results from translation
            termination at the upstream UGA stop codon, while the longer
            isoform (1x) results from UGA stop codon readthrough to the
            downstream UAG termination codon. This RefSeq represents the
            longer, C-terminally extended isoform (1x). As the UGA stop codon
            has been reported to specify several alternative amino acids
            (tryptophan, cysteine, arginine and serine), its location in the
            longer isoform is denoted by an 'X'.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF093097.1, BC063275.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            stop codon readthrough :: PMID: 24949972
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-6                 HY052874.1         15-20
            7-936               BC063275.1         1-930
            937-2787            AK314148.1         912-2762
            2788-7478           AF093097.1         2788-7478
            7479-7479           CR936823.1         6081-6081
            7480-13712          AL139286.13        67508-73740         c
FEATURES             Location/Qualifiers
     source          1..13712
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p34.3"
     gene            1..13712
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="argonaute RISC component 1"
                     /db_xref="GeneID:26523"
                     /db_xref="HGNC:HGNC:3262"
                     /db_xref="MIM:606228"
     exon            1..238
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /inference="alignment:Splign:2.1.0"
     variation       6
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978051547"
     variation       9
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645056876"
     variation       13
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175381189"
     variation       14
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1287948787"
     variation       18
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1488473859"
     variation       19
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1220406709"
     variation       20..45
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="ctcgcagtgggagctgctgcaggctc"
                     /db_xref="dbSNP:1244564144"
     variation       20
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645057149"
     variation       21
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489178234"
     variation       22
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745709197"
     variation       23
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645057343"
     variation       24
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571337067"
     variation       25
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1379140477"
     variation       27
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1442648369"
     variation       28
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645057533"
     variation       32
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1160937987"
     variation       33
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:955272510"
     variation       35
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1166868030"
     variation       37
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571337095"
     variation       38
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1321841535"
     variation       39
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536512687"
     variation       40
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571337106"
     variation       44
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:960542884"
     variation       45
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988496009"
     variation       46..49
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cgcg"
                     /replace="cgcgcg"
                     /db_xref="dbSNP:1330829239"
     variation       46
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:796799611"
     variation       47..57
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gcggcggc"
                     /replace="gcggcggcggc"
                     /replace="gcggcggcggcggc"
                     /db_xref="dbSNP:879546980"
     variation       47
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296078355"
     variation       48
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645058154"
     variation       49..81
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggcggcggc"
                     /replace="ggcggcggcaacggaggctgcgggggcggcggc"
                     /db_xref="dbSNP:1645058301"
     variation       49
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1227464220"
     variation       51
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763454879"
     variation       52
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323203976"
     variation       54
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:968367755"
     variation       55
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237075493"
     variation       56..57
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gc"
                     /replace="gctgc"
                     /db_xref="dbSNP:1645058523"
     variation       57
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978548875"
     variation       58
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181076845"
     variation       59
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239255916"
     variation       62
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645058668"
     variation       65
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867649714"
     variation       68..80
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gcgg"
                     /replace="gcgggggcggcgg"
                     /db_xref="dbSNP:921662839"
     variation       69
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645058877"
     variation       70
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:931863745"
     variation       72..95
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gggc"
                     /replace="gggcggcggcgcgagcggccgggc"
                     /db_xref="dbSNP:1645059013"
     variation       75
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1379985904"
     variation       78
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:941176687"
     variation       79
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1398233997"
     variation       81
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645059243"
     variation       83
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645059390"
     variation       85
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645059442"
     variation       86
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467201069"
     variation       87
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333289576"
     variation       90
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645059570"
     variation       91
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645059619"
     variation       98
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645059665"
     variation       99
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336348406"
     misc_feature    100..102
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="upstream in-frame stop codon"
     variation       101
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1038631951"
     variation       104
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645059778"
     variation       105
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:918304981"
     variation       106
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645059864"
     variation       109
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645059915"
     variation       112
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645059958"
     variation       113
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645060009"
     variation       115
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381028483"
     variation       116
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256973986"
     variation       120
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:929736854"
     variation       121
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645060253"
     variation       126
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1045368943"
     variation       127
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547802847"
     variation       128
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645060435"
     variation       129
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:906900125"
     variation       132
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1003735845"
     variation       135
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:569338309"
     variation       136..140
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gag"
                     /replace="gagag"
                     /db_xref="dbSNP:1645060711"
     variation       137
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645060739"
     variation       138
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:537033546"
     variation       142
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1239615580"
     variation       143
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148706022"
     variation       144
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571337241"
     variation       145
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571337258"
     variation       147
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645060959"
     variation       148
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1055353380"
     variation       150
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645061351"
     variation       151
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645061389"
     variation       155
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895405324"
     variation       156
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011034611"
     variation       159
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193238281"
     variation       162
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645061557"
     variation       163
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376952387"
     variation       164
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478922696"
     variation       165
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:558415281"
     variation       170
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1479948110"
     variation       171
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331202747"
     variation       173..176
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ca"
                     /replace="caca"
                     /db_xref="dbSNP:754610928"
     variation       174
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748181964"
     variation       176
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:767091091"
     variation       178
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1167301864"
     variation       179
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332063452"
     variation       181
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374168686"
     variation       182
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415108216"
     variation       183
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645062143"
     variation       184
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426651719"
     variation       187
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277181222"
     variation       188
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1022891969"
     variation       189
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571337349"
     variation       191
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:570480872"
     variation       193
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1365195293"
     variation       194..198
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="cctcc"
                     /db_xref="dbSNP:1645062511"
     variation       194
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377185293"
     variation       195
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369200771"
     variation       198
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369830249"
     variation       199..200
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ta"
                     /db_xref="dbSNP:1645062720"
     variation       199
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1227307292"
     variation       200
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774749949"
     variation       202
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645062813"
     variation       203
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746274013"
     variation       204
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:999650573"
     variation       205
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1312478731"
     variation       206
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571337398"
     variation       207
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771695172"
     variation       210
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645063088"
     variation       211..213
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1378065562"
     CDS             214..2889
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="isoform 1x is encoded by transcript variant 1;
                     Golgi Endoplasmic Reticulum protein 95 kDa; putative
                     RNA-binding protein Q99; protein argonaute-1; eIF2C 1;
                     eIF-2C 1; argonaute1; eukaryotic translation initiation
                     factor 2C, 1; argonaute 1, RISC catalytic component;
                     argonaute RISC catalytic component 1"
                     /codon_start=1
                     /transl_except=(pos:2785..2787,aa:OTHER)
                     /product="protein argonaute-1 isoform 1x"
                     /protein_id="NP_001304051.1"
                     /db_xref="CCDS:CCDS90915.1"
                     /db_xref="GeneID:26523"
                     /db_xref="HGNC:HGNC:3262"
                     /db_xref="MIM:606228"
                     /translation="
MEAGPSGAAAGAYLPPLQQVFQAPRRPGIGTVGKPIKLLANYFEVDIPKIDVYHYEVDIKPDKCPRRVNREVVEYMVQHFKPQIFGDRKPVYDGKKNIYTVTALPIGNERVDFEVTIPGEGKDRIFKVSIKWLAIVSWRMLHEALVSGQIPVPLESVQALDVAMRHLASMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIEFMCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKNERIGKSGNIPAGTTVDTNITHPFEFDFYLCSHAGIQGTSRPSHYYVLWDDNRFTADELQILTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKEHDSGEGSHISGQSNGRDPQALAKAVQVHQDTLRTMYFAXRQNAVTSLDRRKLSKPQELCHPNPEEARRREVG"
     misc_feature    313..705
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    733..885
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    886..1248
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1042..1044,1087..1089,1129..1131,1141..1143,
                     1195..1197,1216..1218,1222..1224)
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1381..2658
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1792..1794,1804..1806,1840..1851,1858..1860,
                     1882..1884,1891..1893,1903..1905,1915..1917)
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1996..1998,2002..2004,2212..2214,2626..2628)
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="active site"
                     /db_xref="CDD:240015"
     variation       220
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291952738"
     variation       221
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775125489"
     variation       227
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1219859778"
     variation       228
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645063342"
     variation       229
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763615615"
     variation       230
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1228530087"
     variation       231
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776166589"
     variation       233
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761778204"
     variation       234
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571337459"
     variation       235
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645063687"
     variation       237
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765152517"
     exon            239..422
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /inference="alignment:Splign:2.1.0"
     variation       239
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534382148"
     variation       241
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:12746607"
     variation       242
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146814747"
     variation       243
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972036410"
     variation       245
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144077445"
     variation       246
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140869088"
     variation       247
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170596078"
     variation       248
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645155622"
     variation       255
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1340212230"
     variation       256..262
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ccccccc"
                     /replace="cccccccc"
                     /db_xref="dbSNP:752471592"
     variation       258
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645155750"
     variation       259
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206703390"
     variation       260
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760951179"
     variation       261
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202083240"
     variation       262
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557603507"
     variation       263
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148708759"
     variation       264
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138410930"
     variation       266
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757285327"
     variation       269
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1022788713"
     variation       270
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240989789"
     variation       271
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1446100175"
     variation       272
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571342863"
     variation       273
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:79428335"
     variation       274
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75289061"
     variation       275
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645156392"
     variation       276
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76388453"
     variation       279
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645156505"
     variation       281
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645156570"
     variation       284
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645156617"
     variation       286
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779432389"
     variation       287
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258716583"
     variation       288
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163754955"
     variation       289
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645156991"
     variation       290
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389168609"
     variation       297
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424891938"
     variation       298
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750911996"
     variation       300
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:968257736"
     variation       305
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758952997"
     variation       307
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355653345"
     variation       308
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262459523"
     variation       309
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:574337653"
     variation       313
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645157658"
     variation       315
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179019303"
     variation       316
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1335156626"
     variation       319
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747438396"
     variation       321
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1385353517"
     variation       325
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645157898"
     variation       327
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418697160"
     variation       334
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179971147"
     variation       335
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:926553379"
     variation       339
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768283757"
     variation       347
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297216732"
     variation       349
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199891800"
     variation       354
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337673800"
     variation       356
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868103064"
     variation       361
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146957455"
     variation       363
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200988923"
     variation       364
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773153331"
     variation       366
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762965113"
     variation       378
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143228790"
     variation       388
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286109881"
     variation       390
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645158647"
     variation       394
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347111293"
     variation       395
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448364494"
     variation       396
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:74665168"
     variation       397
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764307761"
     variation       398
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1042059854"
     variation       400
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645159128"
     variation       401
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645159199"
     variation       408
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321314626"
     variation       412
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200676269"
     variation       413
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645159446"
     variation       416
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1251930499"
     variation       417
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564776109"
     variation       419
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194249910"
     variation       420
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375999904"
     exon            423..543
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /inference="alignment:Splign:2.1.0"
     variation       426
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755840915"
     variation       429
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1039211966"
     variation       438
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645239978"
     variation       439
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777119725"
     variation       446
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1355230423"
     variation       447
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645240094"
     variation       448
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748876689"
     variation       450
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294130512"
     variation       460
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645240210"
     variation       462
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770982492"
     variation       475
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774432228"
     variation       476
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745615692"
     variation       486
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645240476"
     variation       500
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148710841"
     variation       507
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487074387"
     variation       513
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187568812"
     variation       518
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368596181"
     variation       520
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373509253"
     variation       521
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:998200306"
     variation       522
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771782526"
     variation       525
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775400690"
     variation       529
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645243206"
     variation       537
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761909595"
     variation       538
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371043471"
     variation       542
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773265965"
     exon            544..725
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /inference="alignment:Splign:2.1.0"
     variation       546
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1037229267"
     variation       547
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766471361"
     variation       548
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867858441"
     variation       549
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645251826"
     variation       555
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1479111626"
     variation       556
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645251932"
     variation       559
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645251969"
     variation       561
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774463509"
     variation       562
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645252076"
     variation       564
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1306694761"
     variation       568
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557606462"
     variation       583
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1327559774"
     variation       591
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759929800"
     variation       600
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645252397"
     variation       601
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557606472"
     variation       606
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768140024"
     variation       613
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645252575"
     variation       616
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974811600"
     variation       629
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748561732"
     variation       632
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756518480"
     variation       633
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763796047"
     variation       642
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645252872"
     variation       643
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645252917"
     variation       645
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140048484"
     variation       646
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406926679"
     variation       648
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778531571"
     variation       651
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750019410"
     variation       654
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551846586"
     variation       655
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780052272"
     variation       660
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1295434292"
     variation       661
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1044509129"
     variation       663
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645253450"
     variation       664
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746713624"
     variation       667
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356391187"
     variation       670
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645253604"
     variation       671
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768528277"
     variation       672
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777924524"
     variation       673
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348951466"
     variation       674
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1225740432"
     variation       678
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146336392"
     variation       682
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1398998653"
     variation       684
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771183369"
     variation       685
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645254066"
     variation       686
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774413049"
     variation       688
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1275859576"
     variation       689
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275269608"
     variation       693
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645254286"
     variation       697
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645254328"
     variation       699
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000221753"
     variation       703
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759723959"
     variation       706
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298655751"
     variation       707
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645254551"
     variation       708
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204721590"
     variation       711
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250637242"
     variation       712
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481913947"
     variation       715
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200107860"
     variation       720
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772403603"
     exon            726..862
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /inference="alignment:Splign:2.1.0"
     variation       730
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757928895"
     variation       733
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148711333"
     variation       735
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339623786"
     variation       741
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935986859"
     variation       742
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369913779"
     variation       747..754
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cttct"
                     /replace="cttcttct"
                     /db_xref="dbSNP:1553154062"
     variation       749
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450839608"
     variation       750
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1557606960"
     variation       756
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1216160432"
     variation       758
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196584082"
     variation       759
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:923359271"
     variation       764
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1243777480"
     variation       765
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054485245"
     variation       776
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571348661"
     variation       777
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751539508"
     variation       779
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1553154069"
     variation       780
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754921891"
     variation       782
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645264815"
     variation       786
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645264900"
     variation       789
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571348686"
     variation       794
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388452609"
     variation       795
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645265183"
     variation       796
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148711374"
     variation       797
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780934730"
     variation       800
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:745945344"
     variation       804
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148711380"
     variation       808
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148711383"
     variation       816
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390406046"
     variation       821
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645265474"
     variation       827
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385468503"
     variation       835
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1557607042"
     variation       857
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415969084"
     variation       858
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1320779237"
     variation       861
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645265786"
     exon            863..997
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /inference="alignment:Splign:2.1.0"
     variation       867
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11806527"
     variation       870
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11811275"
     variation       880
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751072190"
     variation       881
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1281040808"
     variation       882
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645271909"
     variation       888
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299243666"
     variation       893
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754906190"
     variation       894
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2296470"
     variation       899
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645272259"
     variation       904
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571349090"
     variation       907
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266180488"
     variation       908
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372933409"
     variation       911
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1204384593"
     variation       913
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255631567"
     variation       915
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201138355"
     variation       918
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1184303864"
     variation       925
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645272758"
     variation       927
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1364687783"
     variation       932
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778966083"
     variation       933
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645272959"
     variation       937
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17855789"
     variation       939
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758584590"
     variation       942
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362228512"
     variation       946
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645273227"
     variation       948
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1010672520"
     variation       952
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1422475379"
     variation       954
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645273440"
     variation       955
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1018151324"
     variation       957
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645273614"
     variation       959
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470621142"
     variation       960
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780175783"
     variation       961
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1400919651"
     variation       965
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645273887"
     variation       971
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645273962"
     variation       972
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747113992"
     variation       973
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645274152"
     variation       978
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769226315"
     variation       987
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350821626"
     exon            998..1085
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /inference="alignment:Splign:2.1.0"
     variation       998
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770562881"
     variation       999..1000
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:34232554"
     variation       1000
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645278321"
     variation       1005
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645278406"
     variation       1010
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773882882"
     variation       1014
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191695845"
     variation       1017
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1428675136"
     variation       1020
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1166366490"
     variation       1028
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645278705"
     variation       1031
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759010563"
     variation       1044
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372555392"
     variation       1045
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645278907"
     variation       1047
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759416843"
     variation       1048
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533050841"
     variation       1050
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292791760"
     variation       1052
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148711775"
     variation       1054..1055
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:2148711782"
     variation       1054
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1162477236"
     variation       1056
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760596663"
     variation       1059
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551240186"
     variation       1060
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571349540"
     variation       1062
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:570547124"
     variation       1063
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645279527"
     variation       1066
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645279588"
     variation       1068
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571349563"
     variation       1069
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571349566"
     variation       1071
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1364584684"
     variation       1072
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761517181"
     variation       1075
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645279945"
     variation       1085
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294234936"
     exon            1086..1233
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /inference="alignment:Splign:2.1.0"
     variation       1086..1141
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="att"
                     /replace="attccccttacagctggagagtggacagactgtggagtgcacagtggc
                     acagtatt"
                     /db_xref="dbSNP:1557608209"
     variation       1086
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753991581"
     variation       1089
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645296230"
     variation       1091
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295256848"
     variation       1092
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:189586551"
     variation       1103
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051022486"
     variation       1107
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238748148"
     variation       1115
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1472903106"
     variation       1116
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372979737"
     variation       1120
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148712287"
     variation       1124
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645296616"
     variation       1126
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306020581"
     variation       1131
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645296748"
     variation       1136
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645296815"
     variation       1146
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050283350"
     variation       1155
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546553880"
     variation       1156
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420666776"
     variation       1161
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645297028"
     variation       1166
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757631001"
     variation       1176
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909137877"
     variation       1177
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411142617"
     variation       1182
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645297285"
     variation       1188
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756155452"
     variation       1189
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338758069"
     variation       1200
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645297454"
     variation       1204
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759454083"
     variation       1212
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359860901"
     variation       1221
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447524690"
     variation       1224
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778306053"
     variation       1227
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149082767"
     variation       1228
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151208943"
     exon            1234..1353
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /inference="alignment:Splign:2.1.0"
     variation       1236
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275974433"
     variation       1240
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148715329"
     variation       1242
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775889960"
     variation       1243
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200563862"
     variation       1244
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557612017"
     variation       1249
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415960544"
     variation       1255
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764062753"
     variation       1257
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050570393"
     variation       1258
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908985871"
     variation       1259
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148715349"
     variation       1263
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645416045"
     variation       1268
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343816827"
     variation       1269
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753994302"
     variation       1277
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278173586"
     variation       1278
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757689155"
     variation       1283
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645416400"
     variation       1284
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645416455"
     variation       1292
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645416507"
     variation       1293
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199616208"
     variation       1296
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1200825557"
     variation       1320
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758791735"
     variation       1324
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148715372"
     variation       1329
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779631833"
     variation       1332
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645416806"
     variation       1334..1341
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aggag"
                     /replace="aggaggag"
                     /db_xref="dbSNP:2148715376"
     variation       1336
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762638025"
     variation       1338
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746619529"
     variation       1340
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1430592479"
     variation       1344
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168233985"
     variation       1346
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1369030058"
     variation       1348
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754699172"
     variation       1350
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274129921"
     variation       1351
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780563736"
     exon            1354..1476
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /inference="alignment:Splign:2.1.0"
     variation       1359
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750947963"
     variation       1360
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1404044449"
     variation       1361
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148715571"
     variation       1364
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148715573"
     variation       1367
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1320886676"
     variation       1370
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645424335"
     variation       1371
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645424415"
     variation       1373
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148715578"
     variation       1374
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645424467"
     variation       1381
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645424528"
     variation       1382
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758951181"
     variation       1386
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72661614"
     variation       1389
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296302699"
     variation       1392
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752028013"
     variation       1395
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002104589"
     variation       1398
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868287969"
     variation       1401
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754573452"
     variation       1404
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328358090"
     variation       1407
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542457159"
     variation       1412
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284524734"
     variation       1415
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780911842"
     variation       1416
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645425246"
     variation       1417
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1226472292"
     variation       1420
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557612417"
     variation       1421
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645425404"
     variation       1423
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645425456"
     variation       1424
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645425501"
     variation       1425
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747545727"
     variation       1430
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148715621"
     variation       1432
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755717690"
     variation       1433
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645425695"
     variation       1438
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1208181934"
     variation       1443
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645425811"
     variation       1447
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571357990"
     variation       1448
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376308772"
     variation       1449
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377394072"
     variation       1451
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544024909"
     variation       1452
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142094247"
     variation       1456
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472015606"
     variation       1458
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161925549"
     variation       1467
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745684571"
     variation       1470
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61751003"
     variation       1471
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893311782"
     variation       1473
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645426498"
     variation       1474
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935068063"
     variation       1475
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645426594"
     exon            1477..1610
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /inference="alignment:Splign:2.1.0"
     variation       1479
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645430270"
     variation       1480
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779760591"
     variation       1481
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258906885"
     variation       1482
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645430440"
     variation       1485
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748337975"
     variation       1486
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428424991"
     variation       1493
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015543488"
     variation       1497
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199936275"
     variation       1503
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773266381"
     variation       1509
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763034859"
     variation       1510
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432427531"
     variation       1515
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771277669"
     variation       1516
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170126627"
     variation       1517
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645431243"
     variation       1519
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148715842"
     variation       1521
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148715846"
     variation       1522
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645431327"
     variation       1523
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370865156"
     variation       1524
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774954734"
     variation       1527
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645431506"
     variation       1530
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759771963"
     variation       1533
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1369633288"
     variation       1537
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645431703"
     variation       1538
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387317470"
     variation       1542
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571358401"
     variation       1544
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313546401"
     variation       1548
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1300648006"
     variation       1553
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371917876"
     variation       1555
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368914800"
     variation       1557
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557612737"
     variation       1564
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753155364"
     variation       1566
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760403306"
     variation       1571
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645432313"
     variation       1572
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375102195"
     variation       1575
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645432435"
     variation       1576
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262161642"
     variation       1577
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753328428"
     variation       1584
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919044941"
     variation       1595
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203451050"
     variation       1606
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:569514136"
     variation       1608
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1023867293"
     exon            1611..1795
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /inference="alignment:Splign:2.1.0"
     variation       1614
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199479145"
     variation       1620
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645532937"
     variation       1623
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645533022"
     variation       1626
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:945694295"
     variation       1630
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775988217"
     variation       1631
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761121371"
     variation       1632
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645533275"
     variation       1637
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12739932"
     variation       1647
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763795877"
     variation       1649
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148718885"
     variation       1650
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184426040"
     variation       1657
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1415613590"
     variation       1660
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1557615824"
     variation       1671
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776441734"
     variation       1674
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769789947"
     variation       1675
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1163885953"
     variation       1689
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1040031325"
     variation       1692
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12735795"
     variation       1694
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:12735796"
     variation       1695
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368806171"
     variation       1699
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1167063899"
     variation       1705
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645534232"
     variation       1707
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458793259"
     variation       1708
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:998417309"
     variation       1713
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340285630"
     variation       1716
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148718923"
     variation       1717
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421049999"
     variation       1718
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645534556"
     variation       1720
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201120683"
     variation       1721
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645534737"
     variation       1722
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1466906554"
     variation       1723
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006126627"
     variation       1724
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321275499"
     variation       1725
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764770945"
     variation       1728
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749967453"
     variation       1731
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758341990"
     variation       1733
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341527708"
     variation       1738
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380272290"
     variation       1739
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143395835"
     variation       1740
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751289476"
     variation       1742
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200447801"
     variation       1743
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754799646"
     variation       1744
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645535695"
     variation       1746
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1050019769"
     variation       1752
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371346774"
     variation       1756
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268149326"
     variation       1763
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645536021"
     variation       1767
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1401160206"
     variation       1776
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645536136"
     variation       1785
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749491572"
     variation       1788
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757463904"
     exon            1796..1955
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /inference="alignment:Splign:2.1.0"
     variation       1806
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645685994"
     variation       1807
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385910631"
     variation       1808
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758585726"
     variation       1810
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645686189"
     variation       1812
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780324190"
     variation       1821
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645686375"
     variation       1824
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148723061"
     variation       1827
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747499045"
     variation       1838
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769346828"
     variation       1839
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199790587"
     variation       1848
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225197236"
     variation       1852
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301736040"
     variation       1853
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1265127399"
     variation       1854..1855
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:1645686932"
     variation       1855..1856
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="gggaacacaataatgac"
                     /db_xref="dbSNP:1645687001"
     variation       1860
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141975081"
     variation       1861
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769429758"
     variation       1862
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645687220"
     variation       1864
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1300821067"
     variation       1865
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571373923"
     variation       1866
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:888769037"
     variation       1872
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645687499"
     variation       1875
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645687560"
     variation       1876
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645687616"
     variation       1883..1886
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1645687661"
     variation       1885
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343928483"
     variation       1890
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148723097"
     variation       1894
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645687783"
     variation       1899
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205604565"
     variation       1911
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139495925"
     variation       1918
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645688251"
     variation       1923
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1038775292"
     variation       1927
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432507106"
     variation       1936
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762483320"
     variation       1941
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778368573"
     variation       1944
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1223700131"
     variation       1947
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247322617"
     variation       1954
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645688704"
     exon            1956..2046
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /inference="alignment:Splign:2.1.0"
     variation       1956
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164256024"
     variation       1962
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770625415"
     variation       1963
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528425591"
     variation       1965
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645692834"
     variation       1971
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771935455"
     variation       1986
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775325449"
     variation       1987
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645693020"
     variation       1995
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557621093"
     variation       1998
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547329659"
     variation       1999
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645693235"
     variation       2004
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753726639"
     variation       2005
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645693386"
     variation       2007..2012
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:35257283"
     variation       2007
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324407912"
     variation       2009
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557621129"
     variation       2010
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150639776"
     variation       2011
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1284611497"
     variation       2013
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149707892"
     variation       2015
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148723245"
     variation       2016
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751632923"
     variation       2025
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1270050276"
     variation       2028
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:568739814"
     variation       2033..2037
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:551219785"
     variation       2036
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1353927503"
     variation       2037
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645694220"
     variation       2038
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201807040"
     variation       2040
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460339268"
     variation       2043
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748183477"
     variation       2044
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756692838"
     exon            2047..2241
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /inference="alignment:Splign:2.1.0"
     variation       2049
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1397084516"
     variation       2051
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:981999787"
     variation       2058
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390797463"
     variation       2060
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756572252"
     variation       2063
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754140760"
     variation       2064
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757637094"
     variation       2065
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779294804"
     variation       2066
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745501471"
     variation       2069
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72661618"
     variation       2071
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645715386"
     variation       2074
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645715448"
     variation       2075
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645715524"
     variation       2078
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645715568"
     variation       2082
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455593427"
     variation       2089
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779428711"
     variation       2095
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746534916"
     variation       2096
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571375783"
     variation       2099
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571375789"
     variation       2103
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348772102"
     variation       2105
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645715985"
     variation       2106
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776733250"
     variation       2107
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1177037855"
     variation       2109
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148723911"
     variation       2110
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747913193"
     variation       2112
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1251138878"
     variation       2119
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548570122"
     variation       2121
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769680596"
     variation       2134..2156
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tcctacatggtgcgtgagctcct"
                     /replace="tcctacatggtgcgtgagctcctacatggtgcgtgagctcct"
                     /db_xref="dbSNP:1553156567"
     variation       2136
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148568098"
     variation       2140
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759663700"
     variation       2144
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767845424"
     variation       2146
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645716713"
     variation       2147
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452226490"
     variation       2151
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645716848"
     variation       2152
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1170223877"
     variation       2154
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775362502"
     variation       2157
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461384946"
     variation       2160
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1296384917"
     variation       2163
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:575591328"
     variation       2172
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764455703"
     variation       2174
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645717324"
     variation       2175
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754370001"
     variation       2179
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148723971"
     variation       2180
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369025845"
     variation       2191
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762360695"
     variation       2192
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1296692574"
     variation       2193
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147571046"
     variation       2194
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750855900"
     variation       2196
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148723986"
     variation       2197
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757924485"
     variation       2199
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779770428"
     variation       2200
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1267744084"
     variation       2202
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1165442477"
     variation       2203
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750985823"
     variation       2209
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213741177"
     variation       2210
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754547764"
     variation       2211
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466822711"
     variation       2212
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645718693"
     variation       2217
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190144851"
     variation       2218
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1262080535"
     variation       2220
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780890292"
     variation       2222
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12564106"
     variation       2228
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769908492"
     variation       2235
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645719049"
     variation       2238
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645719104"
     exon            2242..2376
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /inference="alignment:Splign:2.1.0"
     variation       2243
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tttttttt"
                     /db_xref="dbSNP:1414634162"
     variation       2247
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756047129"
     variation       2249
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565958096"
     variation       2250
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645758202"
     variation       2252
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224957910"
     variation       2255
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:896742034"
     variation       2257
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307134258"
     variation       2259
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748984548"
     variation       2260
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143104504"
     variation       2268
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645758583"
     variation       2271
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282114791"
     variation       2277
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778610016"
     variation       2280
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645758802"
     variation       2283
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209966112"
     variation       2291..2294
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:2148725180"
     variation       2295
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645758944"
     variation       2301
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7512720"
     variation       2310
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020631361"
     variation       2311
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1557623594"
     variation       2319
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768936737"
     variation       2323
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142277966"
     variation       2325
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138262926"
     variation       2326
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645759563"
     variation       2334
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770238895"
     variation       2335
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148725216"
     variation       2336
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773801844"
     variation       2340
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763410885"
     variation       2350
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766745148"
     variation       2357
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1311510365"
     variation       2366
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774636073"
     variation       2374
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1557623659"
     variation       2375
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645760176"
     variation       2376
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759256057"
     exon            2377..2478
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /inference="alignment:Splign:2.1.0"
     variation       2378
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439738572"
     variation       2384
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373512212"
     variation       2394
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759990630"
     variation       2396
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160280075"
     variation       2403
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767227187"
     variation       2408
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645772040"
     variation       2410
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1272181556"
     variation       2412
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1305762819"
     variation       2413
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645772202"
     variation       2414
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015522007"
     variation       2415
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394089472"
     variation       2419
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438949295"
     variation       2420
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328128014"
     variation       2422
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1371847135"
     variation       2423
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775311574"
     variation       2425
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:962129831"
     variation       2433
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278891860"
     variation       2434
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645772715"
     variation       2436
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760440138"
     variation       2442
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763635186"
     variation       2453
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645772906"
     variation       2455
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191993432"
     variation       2457
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370393930"
     variation       2460
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757155977"
     variation       2465
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148725560"
     variation       2466
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765103292"
     variation       2467
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750172296"
     variation       2469
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423532922"
     exon            2479..2678
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /inference="alignment:Splign:2.1.0"
     variation       2481
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761255422"
     variation       2498
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1557624574"
     variation       2502
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765183489"
     variation       2504
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750331557"
     variation       2514
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1396473268"
     variation       2517
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762926752"
     variation       2518
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400980541"
     variation       2520
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309729088"
     variation       2522
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351503366"
     variation       2524
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766150388"
     variation       2525
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371456175"
     variation       2526
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416482791"
     variation       2532
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293818805"
     variation       2535
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148725983"
     variation       2538
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756293606"
     variation       2541
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777869344"
     variation       2547
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753905238"
     variation       2550
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1351616919"
     variation       2555
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148725999"
     variation       2556
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766341150"
     variation       2559
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282516031"
     variation       2560
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571380407"
     variation       2562
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779087158"
     variation       2564
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645787177"
     variation       2577
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746352418"
     variation       2578
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144290045"
     variation       2581
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1316031798"
     variation       2589
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009486066"
     variation       2592
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253810168"
     variation       2602
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148726029"
     variation       2604
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780502108"
     variation       2608
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645787653"
     variation       2619
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139104482"
     variation       2626
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1257568536"
     variation       2627
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1365053413"
     variation       2628
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768309604"
     variation       2631
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645787971"
     variation       2634
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645788028"
     variation       2637
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781573871"
     variation       2641
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157651125"
     variation       2642
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557624739"
     variation       2646
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425163970"
     variation       2648
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867363147"
     variation       2649
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645788386"
     variation       2656
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776181658"
     variation       2658
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1372029994"
     variation       2664
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436350986"
     variation       2670
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571380526"
     variation       2671
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318627286"
     variation       2676
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645788766"
     exon            2679..13712
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /inference="alignment:Splign:2.1.0"
     variation       2679
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571380871"
     variation       2695
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200112017"
     variation       2699
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747745215"
     variation       2700
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537312381"
     variation       2708
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772641687"
     variation       2712
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645794818"
     variation       2717
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230155462"
     variation       2718
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645794950"
     variation       2729
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252403207"
     variation       2730
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1339352983"
     variation       2736
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748808273"
     variation       2742
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367549238"
     variation       2743
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314564307"
     variation       2746
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774302590"
     variation       2749
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759554925"
     variation       2764
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371427797"
     variation       2770
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009951542"
     variation       2772
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778473881"
     variation       2781
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764523718"
     variation       2782
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775410850"
     variation       2784
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761934070"
     misc_feature    2785..2787
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="upstream translation termination codon, use of
                     which results in the shorter isoform 1"
     variation       2790
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765573016"
     variation       2796
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750483408"
     variation       2797
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645796023"
     variation       2798
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645796066"
     variation       2801
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:758585810"
     variation       2805
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766609131"
     variation       2806
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1325491422"
     variation       2807
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1365840620"
     variation       2809
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751988702"
     variation       2812
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755567551"
     variation       2816
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415466187"
     variation       2820
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645796465"
     variation       2822
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399336214"
     variation       2828
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645796571"
     variation       2832
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376748083"
     variation       2833
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217374400"
     variation       2835
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343703234"
     variation       2837
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748552081"
     variation       2843
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:965243292"
     variation       2844
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745575440"
     variation       2846
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438723139"
     variation       2848
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645796975"
     variation       2849
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:558595376"
     variation       2857
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1369626433"
     variation       2865
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645797129"
     variation       2871
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219639480"
     variation       2874
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645797215"
     variation       2877
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645797274"
     variation       2882
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571381154"
     variation       2883
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645797336"
     variation       2887
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571381165"
     variation       2891
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645797421"
     variation       2897
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645797468"
     variation       2899
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1321542247"
     variation       2900..2916
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aggatgccttgtttcct"
                     /replace="aggatgccttgtttcctaaggatgccttgtttcct"
                     /db_xref="dbSNP:1645797586"
     variation       2901
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283260848"
     variation       2902
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645797684"
     variation       2905
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645797727"
     variation       2909
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:953916295"
     variation       2910
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645797820"
     variation       2913
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645797860"
     variation       2914
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571381191"
     variation       2915
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571381199"
     variation       2917
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645798304"
     variation       2918
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314872898"
     variation       2920
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:983883552"
     variation       2925
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879239347"
     variation       2926
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645798493"
     variation       2928
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150023314"
     variation       2930
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571381230"
     variation       2931
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:909582929"
     variation       2932
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1025410190"
     variation       2937
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759347470"
     variation       2938
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571381248"
     variation       2939
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1211269541"
     variation       2940
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485412027"
     variation       2946
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972780830"
     variation       2957
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645799010"
     variation       2958
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478628272"
     variation       2963
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372514513"
     variation       2970
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1406280799"
     variation       2977
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645799213"
     variation       2978
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645799270"
     variation       2985
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645799367"
     variation       2985
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1184496486"
     variation       2987
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1031125362"
     variation       2995
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160196944"
     variation       2998
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645799508"
     variation       2999
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:958110614"
     variation       3000
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:949596040"
     variation       3003
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1263585743"
     variation       3004..3007
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:1645799907"
     variation       3004
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989617377"
     variation       3007
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351587097"
     variation       3008
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982388540"
     variation       3009
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645800054"
     variation       3010
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571381367"
     variation       3011
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571381375"
     variation       3013
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1278837312"
     variation       3015
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1348418143"
     variation       3023
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:541172177"
     variation       3033
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571381393"
     variation       3036
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645800369"
     variation       3038
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202115790"
     variation       3040
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288662217"
     variation       3042
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645800533"
     variation       3045
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645800586"
     variation       3046
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571381418"
     variation       3047..3048
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:878964846"
     variation       3053
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:911352318"
     variation       3058
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426560286"
     variation       3060
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181957464"
     variation       3069
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645800907"
     variation       3071
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645800952"
     variation       3076..3082
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="acaca"
                     /replace="acacaca"
                     /db_xref="dbSNP:977058838"
     variation       3080
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922824952"
     variation       3084
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148726405"
     variation       3086
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360308850"
     variation       3091
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645801187"
     variation       3092..3105
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tg"
                     /replace="tgtgactcacagtg"
                     /db_xref="dbSNP:1645801236"
     variation       3093
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1183336786"
     variation       3097
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938140807"
     variation       3101
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187653963"
     variation       3102
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571381510"
     variation       3103
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645801465"
     variation       3106
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1474331605"
     variation       3108..3110
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:2148726435"
     variation       3108
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541984369"
     variation       3112
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563307920"
     variation       3119
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1400788229"
     variation       3122
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:530845732"
     variation       3124
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645801740"
     variation       3130
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:545735322"
     variation       3131
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1042351647"
     variation       3134
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1411490768"
     variation       3136
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645801948"
     variation       3140
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645801989"
     variation       3141
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760505499"
     variation       3146
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343689135"
     variation       3150
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1055654359"
     variation       3151
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645802314"
     variation       3156
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:901211923"
     variation       3159
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1225506641"
     variation       3163
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894285520"
     variation       3164
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645802528"
     variation       3167
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1285541494"
     variation       3168..3169
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1645802682"
     variation       3168
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645802635"
     variation       3174
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571381598"
     variation       3177
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148726466"
     variation       3180
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645802788"
     variation       3182..3193
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gat"
                     /replace="gatactttagat"
                     /db_xref="dbSNP:1645802823"
     variation       3189
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1644547952"
     variation       3191
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1645802872"
     variation       3194
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645802921"
     variation       3197
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:564987081"
     variation       3199
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:949852940"
     variation       3211
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213406425"
     variation       3212
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273180555"
     variation       3214..3216
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1645803165"
     variation       3219
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1045673538"
     variation       3220
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1206364733"
     variation       3221
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645803305"
     variation       3222
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:903096962"
     variation       3223
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484869602"
     variation       3224
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:998051016"
     variation       3228
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645803490"
     variation       3230
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190778316"
     variation       3231
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1028235058"
     variation       3235
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:573515805"
     variation       3238
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:999569691"
     variation       3259
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166214313"
     variation       3260
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148726515"
     variation       3262..3269
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="aggactag"
                     /db_xref="dbSNP:542709440"
     variation       3264
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889712007"
     variation       3271
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645803888"
     variation       3272
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1169098660"
     variation       3277
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645804021"
     variation       3278..3285
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aagaa"
                     /replace="aagaagaa"
                     /db_xref="dbSNP:1645804185"
     variation       3278..3279
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:763151419"
     variation       3283
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645804239"
     variation       3288
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645804313"
     variation       3291..3293
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aaa"
                     /db_xref="dbSNP:1645804382"
     variation       3300
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645804429"
     variation       3303
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005763656"
     variation       3304
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645804548"
     variation       3306
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1335784510"
     variation       3308
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1016780880"
     variation       3309
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645804829"
     variation       3311
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1010924348"
     variation       3317
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116130930"
     variation       3319
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557625376"
     variation       3321
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294728825"
     variation       3322
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645805224"
     variation       3324
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:972530050"
     variation       3325
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977320190"
     variation       3326
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571381730"
     variation       3327
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1023962631"
     variation       3333
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:16822444"
     variation       3336
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645805569"
     variation       3355
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202542245"
     variation       3360
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645805687"
     variation       3362..3367
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:1481124682"
     variation       3368
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1446614001"
     variation       3370
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645805834"
     variation       3373
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:979769602"
     variation       3382
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982470959"
     variation       3384
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:926829253"
     variation       3385
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645806069"
     variation       3387
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1406617402"
     variation       3390
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1450110270"
     variation       3391
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645806451"
     variation       3393
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645806516"
     variation       3395
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181016113"
     variation       3397..3408
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="ccaccccccacc"
                     /db_xref="dbSNP:1645806646"
     variation       3400
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751161957"
     variation       3402
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157587098"
     variation       3403
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2057606"
     variation       3404
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1402522809"
     variation       3405
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766433433"
     variation       3411
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645807023"
     variation       3413
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645807088"
     variation       3415
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148726602"
     variation       3421
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148726604"
     variation       3423
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:915647003"
     variation       3425
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774454425"
     variation       3427
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420740074"
     variation       3430
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1303406314"
     variation       3431
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645807432"
     variation       3433
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645807482"
     variation       3436
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645807546"
     variation       3437
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645807607"
     variation       3438
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645807682"
     variation       3440
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645807739"
     variation       3442
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329847234"
     variation       3444
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645807828"
     variation       3450
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:945440601"
     variation       3454..3460
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctcc"
                     /replace="ctcctcc"
                     /db_xref="dbSNP:1235948754"
     variation       3457
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275775510"
     variation       3458
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1350357017"
     variation       3459
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645808081"
     variation       3461
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645808119"
     variation       3464
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645808158"
     variation       3465
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949953054"
     variation       3466
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1045968353"
     variation       3471
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759722423"
     variation       3475
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645808328"
     variation       3478
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:570108958"
     variation       3479
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1266648467"
     variation       3483..3492
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="taa"
                     /replace="taatacttaa"
                     /db_xref="dbSNP:1645808475"
     variation       3489..3491
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tta"
                     /replace="ttatta"
                     /db_xref="dbSNP:1431340111"
     variation       3489
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1302778723"
     variation       3494
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042485212"
     variation       3497
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378011808"
     variation       3499
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645808743"
     variation       3500
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645808782"
     variation       3502
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322040566"
     variation       3523
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363876827"
     variation       3524
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767682331"
     variation       3526
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148726670"
     variation       3530
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390382219"
     variation       3532..3540
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cttcc"
                     /replace="cttccttcc"
                     /db_xref="dbSNP:934536365"
     variation       3534
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645809082"
     variation       3535
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1324604644"
     variation       3539
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369176195"
     variation       3540
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:933953211"
     variation       3541
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1275467706"
     variation       3543
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148726687"
     variation       3544
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:544835378"
     variation       3545
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226871979"
     variation       3547
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645809561"
     variation       3553
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645809599"
     variation       3557
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645809645"
     variation       3558
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290514635"
     variation       3559
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756407221"
     variation       3568
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1309107602"
     variation       3575
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1018350753"
     variation       3576
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777135778"
     variation       3577
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645810043"
     variation       3578..3581
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="taat"
                     /replace="taataat"
                     /db_xref="dbSNP:767987739"
     variation       3578
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645810115"
     variation       3588
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1005485340"
     variation       3592
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645810360"
     variation       3597
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267896119"
     variation       3598
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645810475"
     variation       3599..3602
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:899918123"
     variation       3599
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998372574"
     variation       3600
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645810616"
     variation       3602
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1413786257"
     variation       3603
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645810706"
     variation       3604
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1017159938"
     variation       3607
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:897013046"
     variation       3612
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645810809"
     variation       3613
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:993907860"
     variation       3617
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645810891"
     variation       3618
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372299339"
     variation       3620
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1030205426"
     variation       3621
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1490719297"
     variation       3624
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645811096"
     variation       3625
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1366224993"
     variation       3626
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764601080"
     variation       3627
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:983409479"
     variation       3629
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645811328"
     variation       3630
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645811390"
     variation       3631
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645811438"
     variation       3641..3646
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="aggtag"
                     /db_xref="dbSNP:756900274"
     variation       3643
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:564719281"
     variation       3646
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11263836"
     variation       3647
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148726754"
     variation       3650
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310206743"
     variation       3651..3663
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ggaagaaataccc"
                     /db_xref="dbSNP:1645811737"
     variation       3652
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645811799"
     variation       3655
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:868386416"
     variation       3657
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1351444886"
     variation       3660
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571382102"
     variation       3661
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414421664"
     variation       3664
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382775879"
     variation       3666
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645812125"
     variation       3681
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537751988"
     variation       3683
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1310777089"
     variation       3684
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645812276"
     variation       3686..3691
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="agaaag"
                     /db_xref="dbSNP:1323589881"
     variation       3690
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645812383"
     variation       3691
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440689421"
     variation       3693
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645812500"
     variation       3696
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559288688"
     variation       3704
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645812623"
     variation       3705
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1163258781"
     variation       3712
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645812827"
     variation       3715
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:991151309"
     variation       3716
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645812964"
     variation       3723
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645813038"
     variation       3732
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:979737204"
     variation       3733
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645813196"
     variation       3743
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645813267"
     variation       3744
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645813358"
     variation       3746
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645813438"
     variation       3749
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645813486"
     variation       3752
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645813558"
     variation       3754
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253742631"
     variation       3758
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1426728596"
     variation       3762
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:570501842"
     variation       3776
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645813750"
     variation       3780
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180935385"
     variation       3781
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253558654"
     variation       3783
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148726822"
     variation       3786
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425105622"
     variation       3794
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645814149"
     variation       3797
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324508934"
     variation       3799
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:2148726831"
     variation       3801
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645814267"
     variation       3805..3808
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tctc"
                     /replace="tctctc"
                     /db_xref="dbSNP:1645814366"
     variation       3805
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1034039916"
     variation       3806
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:959872642"
     variation       3808
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353978258"
     variation       3809
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:915698048"
     variation       3810
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:989776856"
     variation       3813
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645814620"
     variation       3820
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757779782"
     variation       3825
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645814719"
     variation       3826
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148726853"
     variation       3829
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440196918"
     variation       3831..3838
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cctggcct"
                     /replace="cctggcctggcct"
                     /db_xref="dbSNP:1645814975"
     variation       3831
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1299799751"
     variation       3833
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645815037"
     variation       3834
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571382230"
     variation       3840
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645815140"
     variation       3843
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148726863"
     variation       3847
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645815205"
     variation       3848
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534583086"
     variation       3849
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1381602990"
     variation       3850..3873
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cctccttttctccttattcctcct"
                     /replace="cctccttttctccttattcctccttttctccttattcctcct"
                     /db_xref="dbSNP:1553157181"
     variation       3853
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396729640"
     variation       3861
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294910497"
     variation       3862
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645815599"
     variation       3865
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148726875"
     variation       3866
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363066192"
     variation       3869
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645815689"
     variation       3872
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226112037"
     variation       3874
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:981302878"
     variation       3876
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645815832"
     variation       3878
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1342612616"
     variation       3880
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778328049"
     variation       3881
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745361943"
     variation       3883
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645816080"
     variation       3885
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312596434"
     variation       3886
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645816207"
     variation       3889
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645816260"
     variation       3896
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148726894"
     variation       3897
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645816341"
     variation       3898
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148726901"
     variation       3904
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:934611109"
     variation       3905
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645816494"
     variation       3908
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1361359690"
     variation       3909
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645816630"
     variation       3912
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182044331"
     variation       3913
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645816747"
     variation       3915
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1246905719"
     variation       3921
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:922654018"
     variation       3922
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1228516462"
     variation       3924..3925
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:377610395"
     variation       3930
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780857425"
     variation       3935
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414319373"
     variation       3938..3940
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:546902781"
     variation       3938
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206085009"
     variation       3940
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466769406"
     variation       3946
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645817287"
     variation       3947
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1320079218"
     variation       3950
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645817432"
     variation       3951
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148726946"
     variation       3952
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645817503"
     variation       3953..3957
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tct"
                     /replace="tctct"
                     /db_xref="dbSNP:1645817555"
     variation       3954
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645817611"
     variation       3955
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:914485906"
     variation       3956
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11544095"
     variation       3958
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1645817850"
     variation       3959
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645817948"
     variation       3959
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1039642957"
     variation       3960
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911246481"
     variation       3965
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645818052"
     variation       3966
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645818125"
     variation       3967
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218478003"
     variation       3969
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1383747021"
     variation       3972
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645818278"
     variation       3979
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1474000510"
     variation       3982
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544171570"
     variation       3983
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645818496"
     variation       3984
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645818573"
     variation       3987
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210403066"
     variation       3989
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1267025830"
     variation       3991
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645818774"
     variation       3992
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:941259690"
     variation       3993
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210045144"
     variation       4001
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557625954"
     variation       4002
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998653464"
     variation       4007
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148726995"
     variation       4011
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1419147558"
     variation       4012
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051283965"
     variation       4016
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645819124"
     variation       4021
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:574493933"
     variation       4022
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645819228"
     variation       4024
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645819305"
     variation       4025..4031
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aga"
                     /replace="agaga"
                     /replace="agagaga"
                     /db_xref="dbSNP:1408443115"
     variation       4025
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541523978"
     variation       4026
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645819519"
     variation       4031..4039
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaa"
                     /replace="aaaacaaaa"
                     /db_xref="dbSNP:1645819640"
     variation       4031..4034
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:2148727018"
     variation       4031
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1158708063"
     variation       4036..4039
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1410026095"
     variation       4037
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645819731"
     variation       4040
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645819774"
     variation       4041
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:896976019"
     variation       4044
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1172827157"
     variation       4050
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1401165263"
     variation       4051
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645819984"
     variation       4055
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1451767701"
     variation       4056
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645820089"
     variation       4059
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645820124"
     variation       4060..4061
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:1345756099"
     variation       4065
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1334655869"
     variation       4066
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004367048"
     variation       4068
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1219582033"
     variation       4073
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1287397808"
     variation       4078
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645820515"
     variation       4082
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372998612"
     variation       4085
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017237893"
     variation       4088
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645820656"
     variation       4092
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373319406"
     variation       4094
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645820760"
     variation       4095
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1229745842"
     variation       4096
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1268251248"
     variation       4102
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645820953"
     variation       4103
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645821031"
     variation       4105
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645821074"
     variation       4106
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148727056"
     variation       4114
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:993969649"
     variation       4120
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1012596617"
     variation       4122
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645821231"
     variation       4123
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448552286"
     variation       4126
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1045604964"
     variation       4127
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:906930863"
     variation       4129
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645821420"
     variation       4132
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645821491"
     variation       4140
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489048022"
     variation       4155
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148727077"
     variation       4156
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645821607"
     variation       4157
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1181892531"
     variation       4163
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:557125243"
     variation       4166
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645821728"
     variation       4168..4169
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1645821768"
     variation       4169
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1001311726"
     variation       4170
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1473677704"
     variation       4181..4185
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1645822036"
     variation       4182
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1034417264"
     variation       4184
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645822170"
     variation       4185
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413184561"
     variation       4186
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571382638"
     variation       4189
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571382641"
     variation       4193
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957094857"
     variation       4194
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1011572868"
     variation       4198
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645822564"
     variation       4199
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645822629"
     variation       4200
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971191188"
     variation       4202
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1022507355"
     variation       4204
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148727119"
     variation       4206
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756144267"
     variation       4207
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645822899"
     variation       4213
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645822953"
     variation       4217
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:575345163"
     variation       4220
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978201284"
     variation       4222
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557626132"
     variation       4224..4225
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1645823176"
     variation       4225
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411307035"
     variation       4230
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1322270306"
     variation       4231
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148727135"
     variation       4237
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:924373359"
     variation       4238
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203565985"
     variation       4242
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922791500"
     variation       4248
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645823580"
     variation       4251
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645823649"
     variation       4252
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148727146"
     variation       4253
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546120621"
     variation       4254
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645823762"
     variation       4257
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645823818"
     variation       4259
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444486087"
     variation       4261
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1204943412"
     variation       4263
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:564025142"
     variation       4265
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148727163"
     variation       4266
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376079873"
     variation       4268..4284
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctgcact"
                     /replace="ctgcactgtcctgcact"
                     /db_xref="dbSNP:1645824056"
     variation       4269
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645824109"
     variation       4270
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1250105760"
     variation       4273
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:989931107"
     variation       4278
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645824277"
     variation       4280
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183169742"
     variation       4281
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645824454"
     variation       4283
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645824508"
     variation       4295
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645824577"
     variation       4298
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237116217"
     variation       4303
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471885737"
     variation       4312
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780741067"
     variation       4313
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148727183"
     variation       4316
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:576855548"
     variation       4319
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645824874"
     variation       4322
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541050685"
     variation       4324
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148727191"
     variation       4333
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1425259445"
     variation       4334
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1196156313"
     variation       4336
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424382195"
     variation       4338
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1431327702"
     variation       4339
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329204468"
     variation       4353
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:2148727201"
     variation       4355..4360
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gtgt"
                     /replace="gtgtgt"
                     /db_xref="dbSNP:1645825345"
     variation       4355
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943249793"
     variation       4364
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749624548"
     variation       4366
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645825509"
     variation       4368
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:921234759"
     variation       4376
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645825620"
     variation       4379
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571382858"
     variation       4386
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645825732"
     variation       4389
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382833814"
     variation       4397
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:933993252"
     variation       4398
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645825989"
     variation       4402
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645826036"
     variation       4404
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645826076"
     variation       4407
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1344840620"
     variation       4409
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1291821976"
     variation       4409
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148727232"
     variation       4414
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148727237"
     variation       4417
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645826237"
     variation       4418
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1206299477"
     variation       4419
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051641159"
     variation       4429
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645826361"
     variation       4442
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440880750"
     variation       4443
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:559288072"
     variation       4450
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1404346706"
     variation       4451
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645826631"
     variation       4452
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645826690"
     variation       4454
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1238149641"
     variation       4457
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645826756"
     variation       4458
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571382930"
     variation       4459
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1414972830"
     variation       4460
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645826919"
     variation       4462..4463
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645827004"
     variation       4462
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571382944"
     variation       4463..4464
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:1645827093"
     variation       4463
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199589770"
     variation       4464..4483
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttttttttt"
                     /replace="tttttttttt"
                     /replace="ttttttttttt"
                     /replace="ttttttttttttt"
                     /replace="tttttttttttttt"
                     /replace="tttttttttttttttttt"
                     /replace="ttttttttttttttttttt"
                     /replace="tttttttttttttttttttt"
                     /replace="ttttttttttttttttttttt"
                     /replace="tttttttttttttttttttttt"
                     /replace="ttttttttttttttttttttttt"
                     /replace="tttttttttttttttttttttttt"
                     /replace="ttttttttttttttttttttttttt"
                     /replace="tttttttttttttttttttttttttt"
                     /replace="ttttttttttttttttttttttttttt"
                     /replace="tttttttttttttttttttttttttttt"
                     /replace="ttttttttttttttttttttttttttttt"
                     /db_xref="dbSNP:rs34158936"
     variation       4464
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317317471"
     variation       4474
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:1645827510"
     variation       4478
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:1645827572"
     variation       4481
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645827616"
     variation       4482
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645827660"
     variation       4483..4484
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /replace="ttttttttttttttg"
                     /db_xref="dbSNP:1645827744"
     variation       4483
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1433708088"
     variation       4484
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1324502726"
     variation       4484
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1645827857"
     variation       4484
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:78160010"
     variation       4485..4487
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:2148727293"
     variation       4486
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:80323450"
     variation       4488
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="ttttttat"
                     /db_xref="dbSNP:1344308844"
     variation       4489..4499
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="gagacatgggg"
                     /db_xref="dbSNP:1571383009"
     variation       4489..4494
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="gagaca"
                     /db_xref="dbSNP:1645828118"
     variation       4489
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1221227537"
     variation       4490..4491
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ttt"
                     /db_xref="dbSNP:1571383021"
     variation       4490
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1264465139"
     variation       4491
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645828282"
     variation       4493
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1347685404"
     variation       4494
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1246135635"
     variation       4496..4499
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="gggg"
                     /db_xref="dbSNP:1201553074"
     variation       4499
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571383053"
     variation       4500
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571383061"
     variation       4503
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1202415337"
     variation       4505
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446323086"
     variation       4507
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645828685"
     variation       4509
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645828732"
     variation       4510
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645828797"
     variation       4511
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645828866"
     variation       4513
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645828904"
     variation       4514
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645828946"
     variation       4515
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038777167"
     variation       4517
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645829095"
     variation       4518
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206886008"
     variation       4520
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:887198165"
     variation       4522
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571383099"
     variation       4524..4525
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1246165335"
     variation       4527
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1466173006"
     variation       4528
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148727341"
     variation       4529
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004418882"
     variation       4530
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645829765"
     variation       4531
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148727347"
     variation       4532
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283953973"
     variation       4533
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376878725"
     variation       4535
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185636267"
     variation       4540
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645830052"
     variation       4540
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1038514020"
     variation       4541
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:548345110"
     variation       4547
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645830216"
     variation       4550
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1429539161"
     variation       4555
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141020163"
     variation       4557
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1317924229"
     variation       4566
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1045574832"
     variation       4567
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390154190"
     variation       4570..4575
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ccccc"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:1264240367"
     variation       4570
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:907066780"
     variation       4573
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:531001823"
     variation       4574
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1235875938"
     variation       4576
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645830802"
     variation       4576
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1480146316"
     variation       4578..4580
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1571383214"
     variation       4578
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645830860"
     variation       4582
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1001277575"
     variation       4586
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197277733"
     variation       4587
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1379454699"
     variation       4588
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1022652520"
     variation       4590
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1157971224"
     variation       4591
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1382485104"
     variation       4592
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:971502052"
     variation       4593..4595
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1205659617"
     variation       4594
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1298430299"
     variation       4595
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:552938102"
     variation       4596
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645831457"
     variation       4597
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1266582286"
     variation       4598
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645831573"
     variation       4599..4605
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /replace="ttttttttttttt"
                     /db_xref="dbSNP:1364497161"
     variation       4605
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645831800"
     variation       4610..4613
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:1645831867"
     variation       4612
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1002538732"
     variation       4614
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031870725"
     variation       4615
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472079739"
     variation       4617
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:955779820"
     variation       4622
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302700761"
     variation       4628
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571383330"
     variation       4629
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645832314"
     variation       4633
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645832379"
     variation       4637
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3767701"
     variation       4638
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645832571"
     variation       4639
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148727431"
     variation       4643
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645832655"
     variation       4646
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1413552657"
     variation       4648
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453774936"
     variation       4651
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163253086"
     variation       4657
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:535305390"
     variation       4658..4660
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1645833042"
     variation       4660
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1388934119"
     variation       4661
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:546631807"
     variation       4665
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:989942450"
     variation       4666..4676
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gcctgggcttg"
                     /db_xref="dbSNP:1645833247"
     variation       4669
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:892881648"
     variation       4670
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571383382"
     variation       4678
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645833421"
     variation       4679
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011206378"
     variation       4680
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567921238"
     variation       4682
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:966909637"
     variation       4684
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:914383203"
     variation       4687
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571383404"
     variation       4690
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:999755697"
     variation       4696
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264842778"
     variation       4702..4703
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1645833861"
     variation       4704
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1354127015"
     variation       4706
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645833991"
     variation       4711
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529226907"
     variation       4718
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1224575972"
     variation       4719
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148727485"
     variation       4729
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11263837"
     variation       4731..4747
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tggagg"
                     /replace="tggaggccagctggagg"
                     /db_xref="dbSNP:1482570994"
     variation       4732
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:955570714"
     variation       4738
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645834334"
     variation       4740
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1490230038"
     variation       4741
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1252219325"
     variation       4753
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571383462"
     variation       4754
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:985943795"
     variation       4757
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147872657"
     variation       4759..4761
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1367279967"
     variation       4767
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645834800"
     variation       4769
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645834859"
     variation       4770
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645834930"
     variation       4774
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645835003"
     variation       4778
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:575432473"
     variation       4783
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148727526"
     variation       4784
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1164723063"
     variation       4787
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557626633"
     variation       4793
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180986599"
     variation       4796
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538396559"
     variation       4797
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441473989"
     variation       4798
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645835457"
     variation       4802
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645835540"
     variation       4803
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645835612"
     variation       4807
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1158965724"
     variation       4808
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645835712"
     variation       4811
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645835761"
     variation       4813
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768629161"
     variation       4817
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1422319454"
     variation       4819
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645835966"
     variation       4820
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539225992"
     variation       4829
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390797034"
     variation       4830
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645836125"
     variation       4836
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390373559"
     variation       4838
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1328762082"
     variation       4839..4845
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="atc"
                     /replace="atctatc"
                     /db_xref="dbSNP:1248093606"
     variation       4839
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940048856"
     variation       4840..4842
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:1341276282"
     variation       4842
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645836434"
     variation       4843
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549478819"
     variation       4846
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645836515"
     variation       4849
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:981391115"
     variation       4853
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645836622"
     variation       4854
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928450240"
     variation       4858
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571383569"
     variation       4861
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645836781"
     variation       4870
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645836821"
     variation       4876
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645836891"
     variation       4876
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937119553"
     variation       4879
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:898638537"
     variation       4881
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:948854920"
     variation       4884
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1045068402"
     variation       4886
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1056043426"
     variation       4888
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571383595"
     variation       4891
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002958675"
     variation       4892
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374604719"
     variation       4894
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891564764"
     variation       4900
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645837338"
     variation       4902..4909
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="catt"
                     /replace="cattcatt"
                     /db_xref="dbSNP:568286493"
     variation       4912
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779127991"
     variation       4916
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645837495"
     variation       4922
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645837557"
     variation       4932
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645837592"
     variation       4933
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1172946442"
     variation       4936..4940
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="taact"
                     /replace="taactaact"
                     /db_xref="dbSNP:763091191"
     variation       4939..4946
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctcct"
                     /replace="ctcctcct"
                     /db_xref="dbSNP:1465749168"
     variation       4939
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301254589"
     variation       4940
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1404445156"
     variation       4941
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:566005717"
     variation       4942
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645837930"
     variation       4960
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:557502697"
     variation       4964..4971
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gc"
                     /replace="gctacagc"
                     /db_xref="dbSNP:1557626785"
     variation       4966
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776479735"
     variation       4968
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267521187"
     variation       4972
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645838154"
     variation       4973
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645838239"
     variation       4982
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748073066"
     variation       4984
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357140818"
     variation       4986
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148920115"
     variation       4989
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645838456"
     variation       4991
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1041364990"
     variation       4992..4993
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645838643"
     variation       4992
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645838592"
     variation       4993
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645838705"
     variation       5000
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:551183965"
     variation       5001
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307814250"
     variation       5010
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1232095258"
     variation       5012
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645838886"
     variation       5014
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645838928"
     variation       5020
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645838966"
     variation       5021
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253817472"
     variation       5023
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559700666"
     variation       5028..5029
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1203738330"
     variation       5033
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645839164"
     variation       5034
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247992782"
     variation       5035
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571383731"
     variation       5038
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1179212155"
     variation       5039
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974546690"
     variation       5045
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645839412"
     variation       5046
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645839464"
     variation       5047
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999722784"
     variation       5052
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029906678"
     variation       5056
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:574738407"
     variation       5057
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1432895085"
     variation       5058
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:891379793"
     variation       5061
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645839882"
     variation       5062
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1174300866"
     variation       5074..5079
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agag"
                     /replace="agagag"
                     /db_xref="dbSNP:1030698125"
     variation       5078
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954617636"
     variation       5085
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645840096"
     variation       5090..5092
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="act"
                     /db_xref="dbSNP:1645840140"
     variation       5091
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645840201"
     variation       5093..5094
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1645840255"
     variation       5094
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645840310"
     variation       5097
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1319940523"
     variation       5099
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645840847"
     variation       5100
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749135264"
     variation       5101
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987209249"
     variation       5106
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557626922"
     variation       5107
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571383810"
     variation       5108
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908518241"
     variation       5111
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1362408292"
     variation       5120
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298812667"
     variation       5122
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645841240"
     variation       5125
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940101447"
     variation       5128
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645841340"
     variation       5129
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645841375"
     variation       5132
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774314069"
     variation       5133
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645841478"
     variation       5135
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1018878974"
     variation       5138
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1326383796"
     variation       5142
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645841621"
     variation       5143
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:962811047"
     variation       5144
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569028747"
     variation       5145
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218561159"
     variation       5146
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645841805"
     variation       5148
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:974593532"
     variation       5157
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1243192888"
     variation       5158
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1488390585"
     variation       5163
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148727754"
     variation       5165
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401866702"
     variation       5169
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148727758"
     variation       5176
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148727763"
     variation       5182
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1271378698"
     variation       5183
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1025644941"
     variation       5184
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528581690"
     variation       5185
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645842188"
     variation       5187
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759576331"
     variation       5190
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645842281"
     variation       5192
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645842329"
     variation       5194
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919992705"
     variation       5199
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1409869642"
     variation       5207
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645842477"
     variation       5209..5212
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:948897736"
     variation       5209
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645842520"
     variation       5211
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161287709"
     variation       5212
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1382484440"
     variation       5213..5229
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctaggatcagggcacta"
                     /replace="ctaggatcagggcactaggatcagggcacta"
                     /db_xref="dbSNP:1645842729"
     variation       5213
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645842691"
     variation       5215
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345701651"
     variation       5217
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142820733"
     variation       5221..5222
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1645842850"
     variation       5227
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1435560919"
     variation       5229
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645842923"
     variation       5233
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11584551"
     variation       5234
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301096853"
     variation       5235
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1347106387"
     variation       5236
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645843246"
     variation       5238
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1405193284"
     variation       5242
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:951399769"
     variation       5243
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1315279151"
     variation       5245
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645843426"
     variation       5248
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645843474"
     variation       5250..5251
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tc"
                     /db_xref="dbSNP:1322495713"
     variation       5259..5261
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1645843565"
     variation       5261
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148727824"
     variation       5265
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044534109"
     variation       5266
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1285628921"
     variation       5272
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226998190"
     variation       5273
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645843752"
     variation       5274
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571384016"
     variation       5280
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219960188"
     variation       5283
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1294435310"
     variation       5284
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645843975"
     variation       5285
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645844021"
     variation       5286
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571384041"
     variation       5287
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645844138"
     variation       5291
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:907449262"
     variation       5293
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536462158"
     variation       5298
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:563614918"
     variation       5307
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181737936"
     variation       5313
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1249885644"
     variation       5315
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:531160067"
     variation       5316..5325
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttctctcctt"
                     /replace="ttctctccttctctcctt"
                     /db_xref="dbSNP:1645844480"
     variation       5318
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645844528"
     variation       5323..5325
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ctt"
                     /db_xref="dbSNP:1645844611"
     variation       5323
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:552823877"
     variation       5325
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:879655926"
     variation       5329
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645844688"
     variation       5331
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404716895"
     variation       5332
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1161533657"
     variation       5334
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367212903"
     variation       5335
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425058234"
     variation       5337
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645844925"
     variation       5338
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571384105"
     variation       5339
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645845050"
     variation       5339
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1307085474"
     variation       5341
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645845099"
     variation       5344
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148727887"
     variation       5349
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767735487"
     variation       5350
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552050201"
     variation       5354
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:528802065"
     variation       5364
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443788207"
     variation       5365
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645845349"
     variation       5367
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190099919"
     variation       5368
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645845472"
     variation       5371
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256609372"
     variation       5372
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645845584"
     variation       5378
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021369384"
     variation       5381
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:947143594"
     variation       5387
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645845708"
     variation       5388
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182744550"
     variation       5389
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571384166"
     variation       5395
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204874862"
     variation       5396
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645845899"
     variation       5401
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148727918"
     variation       5403
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645845949"
     variation       5408
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1272814860"
     variation       5411
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1190613951"
     variation       5416
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645846085"
     variation       5422
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645846135"
     variation       5426
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645846189"
     variation       5427
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151051297"
     variation       5432
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1205425860"
     variation       5435
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465746348"
     variation       5436
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1172008691"
     variation       5438
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571384210"
     variation       5439
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1471812605"
     variation       5443
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148727946"
     variation       5446
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405911669"
     variation       5450
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645846538"
     variation       5451
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902852262"
     variation       5452
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645846623"
     variation       5453
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645846660"
     variation       5455
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:954806567"
     variation       5456
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645846742"
     variation       5458
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:983361467"
     variation       5464
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645846852"
     variation       5470
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1645846900"
     variation       5471
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645846957"
     variation       5473..5479
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /db_xref="dbSNP:1645847010"
     variation       5485..5488
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aaga"
                     /db_xref="dbSNP:1645847063"
     variation       5490
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148727972"
     variation       5496
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167691315"
     variation       5498
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645847159"
     variation       5501
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1394022800"
     variation       5503
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:932947717"
     variation       5506
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645847305"
     variation       5509..5511
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ata"
                     /replace="atata"
                     /db_xref="dbSNP:1329050564"
     variation       5511
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645847415"
     variation       5512..5515
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1358079609"
     variation       5515
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772382251"
     variation       5516
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550680342"
     variation       5519
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384154969"
     variation       5521
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645847733"
     variation       5522
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:961395198"
     variation       5524
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645847828"
     variation       5524
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1645847862"
     variation       5526
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645847914"
     variation       5528
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148728004"
     variation       5543
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645847954"
     variation       5545
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764511304"
     variation       5546
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1341839128"
     variation       5547
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187348990"
     variation       5550
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278180244"
     variation       5552
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440823891"
     variation       5554
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1645848224"
     variation       5555
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645848273"
     variation       5561
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:970088425"
     variation       5563
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645848359"
     variation       5564..5569
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gtg"
                     /replace="gtggtg"
                     /db_xref="dbSNP:1645848479"
     variation       5564
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1276597545"
     variation       5566
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1461734061"
     variation       5568
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571384324"
     variation       5569
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1342434963"
     variation       5575
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645848655"
     variation       5579
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219399290"
     variation       5587
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:539113284"
     variation       5588
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980694120"
     variation       5589
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371146862"
     variation       5590..5591
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:1645848996"
     variation       5590
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:891356896"
     variation       5591
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645849048"
     variation       5592
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401665842"
     variation       5596
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310304736"
     variation       5600
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645849252"
     variation       5614
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928789700"
     variation       5617
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256324753"
     variation       5619
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467820619"
     variation       5620
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557539448"
     variation       5621
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645849521"
     variation       5623
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148728056"
     variation       5625
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754200663"
     variation       5626
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645849600"
     variation       5627..5628
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:749776818"
     variation       5636..5638
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gtg"
                     /db_xref="dbSNP:1645849756"
     variation       5636
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757754773"
     variation       5638
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1435029828"
     variation       5640..5641
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1316774797"
     variation       5640
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1320249981"
     variation       5642..5646
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1328627531"
     variation       5642
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645849999"
     variation       5643
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645850105"
     variation       5644
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645850140"
     variation       5646
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557627407"
     variation       5648..5652
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ccccc"
                     /db_xref="dbSNP:1645850330"
     variation       5648..5652
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:770805142"
     variation       5648
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1018434015"
     variation       5650
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645850511"
     variation       5652
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:898696084"
     variation       5655
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645850599"
     variation       5656
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1274532947"
     variation       5659
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:41308339"
     variation       5664
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645850811"
     variation       5671..5673
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1645850893"
     variation       5671
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645850851"
     variation       5673
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225535156"
     variation       5675
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1477947563"
     variation       5676
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1025695548"
     variation       5678
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197997922"
     variation       5680
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1263862850"
     variation       5683
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:951451722"
     variation       5685
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645851215"
     variation       5688
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1328507462"
     variation       5689
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645851305"
     variation       5693
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002846536"
     variation       5705
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204485880"
     variation       5706
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1035711401"
     variation       5707
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1426622329"
     variation       5708
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645851511"
     variation       5713
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448579369"
     variation       5714
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645851605"
     variation       5717
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645851648"
     variation       5722
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148728166"
     variation       5724..5726
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="ttt"
                     /db_xref="dbSNP:1193605967"
     variation       5724
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:958630214"
     variation       5728
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645851808"
     variation       5732
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479270221"
     variation       5739
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148728182"
     variation       5740
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1178071830"
     variation       5741
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645851930"
     variation       5747
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645851973"
     variation       5751
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1042669059"
     variation       5753
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456242492"
     variation       5756
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645852094"
     variation       5758..5761
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:759259838"
     variation       5758
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645852142"
     variation       5761..5772
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tgcttgcttgct"
                     /replace="tgcttgcttgcttgct"
                     /db_xref="dbSNP:900265053"
     variation       5761
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645852241"
     variation       5762
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645852361"
     variation       5766
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401689084"
     variation       5769
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645852451"
     variation       5770
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191912446"
     variation       5772..5773
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tgctggcc"
                     /db_xref="dbSNP:1553157487"
     variation       5773..5780
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggcc"
                     /replace="ggccggcc"
                     /replace="ggccggccggcc"
                     /db_xref="dbSNP:1296575768"
     variation       5774..5788
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gccggcctgcctgcc"
                     /replace="gccggcctgcctgccggcctgcctgcc"
                     /db_xref="dbSNP:1362617855"
     variation       5774..5784
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gccggcctgcc"
                     /replace="gccggcctgccggcctgcc"
                     /db_xref="dbSNP:1645852668"
     variation       5775
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645852759"
     variation       5776
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:914403513"
     variation       5777
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968992815"
     variation       5778..5810
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gcctgcctgcctg"
                     /replace="gcctgcctgcctgcctg"
                     /replace="gcctgcctgcctgcctgcctg"
                     /replace="gcctgcctgcctgcctgcctgcctg"
                     /replace="gcctgcctgcctgcctgcctgcctgcctg"
                     /replace="gcctgcctgcctgcctgcctgcctgcctgcctg"
                     /replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctg"
                     /replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctg"
                     /replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctg"
                     /replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcct
                     g"
                     /replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcct
                     gcctg"
                     /replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcct
                     gcctgcctg"
                     /db_xref="dbSNP:rs372821782"
     variation       5778
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1282666371"
     variation       5780
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645853224"
     variation       5781
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1365616037"
     variation       5781
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:977225175"
     variation       5782..5788
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gcctgcc"
                     /replace="gcctgccggcctgcc"
                     /db_xref="dbSNP:747270933"
     variation       5782
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1426944064"
     variation       5784..5817
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctgcct"
                     /replace="ctgcctgcctgcctgcctgcctgcctgtctgcct"
                     /db_xref="dbSNP:1571384632"
     variation       5784
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301971013"
     variation       5785
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1370162251"
     variation       5786
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1389789240"
     variation       5788..5817
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctgcctgcctgcctgcctgcctgtctgcct"
                     /replace="ctgcctgcctgcctgcctgcctgtctgcctgcctgcctgcctgcctgt
                     ctgcct"
                     /db_xref="dbSNP:1645853684"
     variation       5789
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645853731"
     variation       5792..5817
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctgcct"
                     /replace="ctgcctgcctgcctgcctgtctgcct"
                     /replace="ctgcctgcctgcctgcctgtctgcctgcctgcctgcctgtctgcct"
                     /db_xref="dbSNP:1645853771"
     variation       5793
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1316118886"
     variation       5794
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309282984"
     variation       5795
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645854320"
     variation       5796..5817
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctgcct"
                     /replace="ctgcctgcctgcctgtctgcct"
                     /db_xref="dbSNP:1336375849"
     variation       5798
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571384653"
     variation       5799
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:963254787"
     variation       5800..5817
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctgcct"
                     /replace="ctgcctgcctgtctgcct"
                     /replace="ctgcctgcctgtctgcctgcctgtctgcct"
                     /db_xref="dbSNP:1237611797"
     variation       5802
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645854627"
     variation       5803
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555364099"
     variation       5804..5817
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctgcct"
                     /replace="ctgcctgtctgcct"
                     /replace="ctgcctgtctgcctgtctgcct"
                     /db_xref="dbSNP:1287917302"
     variation       5804
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292098066"
     variation       5805
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645854848"
     variation       5806
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645854897"
     variation       5807
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557627632"
     variation       5808..5819
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ctgtctgcctat"
                     /db_xref="dbSNP:1252062550"
     variation       5808..5814
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctg"
                     /replace="ctgtctg"
                     /replace="ctgtctgtctg"
                     /db_xref="dbSNP:200133723"
     variation       5808..5810
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctg"
                     /replace="ctgactg"
                     /db_xref="dbSNP:1553157504"
     variation       5810..5811
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="cc"
                     /db_xref="dbSNP:770398111"
     variation       5811..5812
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="gc"
                     /db_xref="dbSNP:1645855334"
     variation       5811
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112770520"
     variation       5812..5817
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctgcct"
                     /replace="ctgcctgcct"
                     /db_xref="dbSNP:1183589156"
     variation       5813
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645855424"
     variation       5814
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:571445890"
     variation       5816
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645855513"
     variation       5833
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645855558"
     variation       5835
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645855603"
     variation       5840
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383916478"
     variation       5844
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051361821"
     variation       5848
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164574343"
     variation       5849
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645855799"
     variation       5855
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1389894962"
     variation       5857
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1221324706"
     variation       5862
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1026961947"
     variation       5864
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:910240712"
     variation       5867
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395510442"
     variation       5868
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942960160"
     variation       5870
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757921944"
     variation       5871
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1489203442"
     variation       5875
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1380448830"
     variation       5876
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1193414679"
     variation       5877
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571384799"
     variation       5879
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775414815"
     variation       5881
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645856560"
     variation       5883
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315494134"
     variation       5884
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898752248"
     variation       5885
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1224797571"
     variation       5890
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:928691509"
     variation       5891
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1202463972"
     variation       5892
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996046803"
     variation       5895
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645856886"
     variation       5896
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148728410"
     variation       5898
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1419008182"
     variation       5901..5902
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1241877536"
     variation       5901
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463077268"
     variation       5902
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047275375"
     variation       5903
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645857163"
     variation       5905
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1184703413"
     variation       5908
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:887166316"
     variation       5909
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1427104575"
     variation       5911
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002980449"
     variation       5916
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420492800"
     variation       5924
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645857445"
     variation       5933
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645857490"
     variation       5935..5936
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1645857539"
     variation       5936
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645857582"
     variation       5939
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645857646"
     variation       5943
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1302816968"
     variation       5946
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1035677605"
     variation       5951
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:913494355"
     variation       5952
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148728446"
     variation       5953
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645857860"
     variation       5955
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645857900"
     variation       5962
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1557627845"
     variation       5971
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645857980"
     variation       5978
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571384916"
     variation       5979
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1174403877"
     variation       5987
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762492099"
     variation       5992
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:958990209"
     variation       5993
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779696256"
     variation       5995
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1337231783"
     variation       6001
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1380300635"
     variation       6005
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645858678"
     variation       6008
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1297341203"
     variation       6009
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1307689490"
     variation       6014
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:947601773"
     variation       6018
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260732717"
     variation       6024
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645859042"
     variation       6027
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645859089"
     variation       6032
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324999845"
     variation       6034
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204871772"
     variation       6039
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1438787912"
     variation       6042
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645859379"
     variation       6044
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1021921367"
     variation       6045
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968671573"
     variation       6053
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763849097"
     variation       6055
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645859555"
     variation       6058
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042724086"
     variation       6059
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645859650"
     variation       6060
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645859708"
     variation       6061
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567274274"
     variation       6076
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72661619"
     variation       6077
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150347120"
     variation       6081..6085
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1431544208"
     variation       6084
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987216748"
     variation       6085
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546276346"
     variation       6086
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470343952"
     variation       6088
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:910216586"
     variation       6093
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344515647"
     variation       6108
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645860254"
     variation       6114
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192229737"
     variation       6117
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290445387"
     variation       6118
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362339452"
     variation       6124
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403969851"
     variation       6128
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645860504"
     variation       6129
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1244761611"
     variation       6129
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287368967"
     variation       6131
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1037381878"
     variation       6136
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645860681"
     variation       6140
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148728519"
     variation       6142
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1280900615"
     variation       6146
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645860783"
     variation       6153
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1346907933"
     variation       6154
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:920145968"
     variation       6155
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645860929"
     variation       6163
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528689854"
     variation       6165
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645861030"
     variation       6166
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284226539"
     variation       6168
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:931573500"
     variation       6170
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315693552"
     variation       6171
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:540957769"
     variation       6182..6185
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:1221573684"
     variation       6183
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645861365"
     variation       6188
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368046981"
     variation       6190..6199
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gagaa"
                     /replace="gagaagagaa"
                     /db_xref="dbSNP:1645861470"
     variation       6194
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1490268876"
     variation       6200
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231826043"
     variation       6202
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457670138"
     variation       6204
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1220619177"
     variation       6206
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1271306211"
     variation       6213
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1047241439"
     variation       6217
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1004756207"
     variation       6220
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645861848"
     variation       6227
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405839722"
     variation       6235
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769653660"
     variation       6242
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645861970"
     variation       6255
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417265705"
     variation       6257
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148728576"
     variation       6264
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161126832"
     variation       6266
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360937850"
     variation       6268..6272
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gatcc"
                     /replace="gatccgatcc"
                     /db_xref="dbSNP:1645862149"
     variation       6277
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562224713"
     variation       6279
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:899097755"
     variation       6282
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1002947890"
     variation       6284
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1057471908"
     variation       6288
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645862459"
     variation       6292
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645862508"
     variation       6294
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138074007"
     variation       6295
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645862610"
     variation       6303
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645862666"
     variation       6305
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1440747757"
     variation       6308
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645862778"
     variation       6309
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162890296"
     variation       6313
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645862869"
     variation       6319
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894562681"
     variation       6321
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754406043"
     variation       6323
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148728607"
     variation       6328
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772201195"
     variation       6332
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148728609"
     variation       6345
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645863100"
     variation       6346
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645863154"
     variation       6347
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1021640249"
     variation       6353
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141089342"
     variation       6354
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998758461"
     variation       6355
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1244212532"
     variation       6355
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1294278586"
     variation       6357
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1490584781"
     variation       6358
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:960365327"
     variation       6359
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775545090"
     variation       6360
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481620700"
     variation       6362
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:568795494"
     variation       6364
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380815145"
     variation       6365
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645863841"
     variation       6369
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987268068"
     variation       6377
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443819358"
     variation       6380
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144915813"
     variation       6382
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571385299"
     variation       6383
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645864076"
     variation       6385
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645864138"
     variation       6386
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1377348939"
     variation       6387
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645864227"
     variation       6393
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374706238"
     variation       6394
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113615155"
     variation       6396
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645864372"
     variation       6401
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645864425"
     variation       6402
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1282216452"
     variation       6408
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645864544"
     variation       6409
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645864590"
     variation       6412
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405605719"
     variation       6414
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645864668"
     variation       6416
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380813945"
     variation       6418
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:973456920"
     variation       6419
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148728666"
     variation       6420
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645864840"
     variation       6421
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645864882"
     variation       6423
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760929529"
     variation       6426
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551057779"
     variation       6429
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645865280"
     variation       6430
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332689680"
     variation       6432
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114256824"
     variation       6433
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197273641"
     variation       6435
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645865489"
     variation       6437
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184309288"
     variation       6449
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:983063796"
     variation       6453
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260624813"
     variation       6454..6458
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1645865803"
     variation       6456
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458613385"
     variation       6458
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645865916"
     variation       6459
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922161015"
     variation       6465..6473
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttttt"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /replace="tttttttttt"
                     /db_xref="dbSNP:370557448"
     variation       6465
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309399501"
     variation       6471
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645866192"
     variation       6472
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645866233"
     variation       6473..6474
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="aaa"
                     /db_xref="dbSNP:1645866326"
     variation       6473
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987536748"
     variation       6474
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1187213249"
     variation       6475
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571385436"
     variation       6476
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1236111557"
     variation       6477..6479
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:911645288"
     variation       6480
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1473876167"
     variation       6484
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181616122"
     variation       6489
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940409522"
     variation       6496
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1472999025"
     variation       6499..6500
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:1167019359"
     variation       6499
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645866716"
     variation       6500
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1182705289"
     variation       6504..6509
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gggcag"
                     /db_xref="dbSNP:1645866894"
     variation       6506
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1036208175"
     variation       6511
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571385482"
     variation       6516
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645867033"
     variation       6517
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148728745"
     variation       6518
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555660904"
     variation       6520..6526
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="act"
                     /replace="actgact"
                     /db_xref="dbSNP:1422983575"
     variation       6520
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404662978"
     variation       6522
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645867197"
     variation       6526
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1451113438"
     variation       6527
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1339192698"
     variation       6529
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1341515389"
     variation       6532
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430446901"
     variation       6535
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464188223"
     variation       6537
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645867423"
     variation       6540
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645867458"
     variation       6543
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645867490"
     variation       6544
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1364387032"
     variation       6551
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645867572"
     variation       6555
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:572628298"
     variation       6558..6559
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1201765786"
     variation       6562
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645867751"
     variation       6566
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:930444612"
     variation       6568
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645867836"
     variation       6575
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1045041411"
     variation       6576
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:530603610"
     variation       6583
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78530614"
     variation       6584..6585
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:1476204564"
     variation       6584
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645868037"
     variation       6585
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894522255"
     variation       6587
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776882598"
     variation       6592
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645868215"
     variation       6594
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645868270"
     variation       6596
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1448255656"
     variation       6599
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1269278192"
     variation       6600
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948849183"
     variation       6603..6604
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1645868454"
     variation       6606
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645868500"
     variation       6607
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762170192"
     variation       6609
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043438858"
     variation       6612
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645868671"
     variation       6613
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571385608"
     variation       6617
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1403509038"
     variation       6618
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645868786"
     variation       6620
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645868819"
     variation       6624
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:904567735"
     variation       6632..6633
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1400592274"
     variation       6633..6640
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tca"
                     /replace="tcatctca"
                     /db_xref="dbSNP:1219867000"
     variation       6633
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645868959"
     variation       6635
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645869071"
     variation       6636
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645869125"
     variation       6638
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645869167"
     variation       6639
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765675340"
     variation       6640..6642
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1328506458"
     variation       6643
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571385649"
     variation       6647
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1319157924"
     variation       6651
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1343778835"
     variation       6654
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:557084074"
     variation       6662
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1036062361"
     variation       6664
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276584304"
     variation       6669
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895920140"
     variation       6671
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276910052"
     variation       6672..6673
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1645869877"
     variation       6672
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:575661209"
     variation       6673
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645869937"
     variation       6674
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645869988"
     variation       6677
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1010249007"
     variation       6679
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:2148728856"
     variation       6679
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645870081"
     variation       6680
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1020314191"
     variation       6681
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546362220"
     variation       6690
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1479199859"
     variation       6692
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645870356"
     variation       6694
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890382760"
     variation       6695
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008657978"
     variation       6698
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763548820"
     variation       6702
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1157272761"
     variation       6704
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645870598"
     variation       6705
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:953725615"
     variation       6709
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645870679"
     variation       6710
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:964799598"
     variation       6713
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302826706"
     variation       6720
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645870815"
     variation       6723
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973205940"
     variation       6730
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911516959"
     variation       6731
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645870970"
     variation       6734
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195863102"
     variation       6736
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424452573"
     variation       6740..6745
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctt"
                     /replace="cttctt"
                     /db_xref="dbSNP:1477632037"
     variation       6740
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:940323449"
     variation       6743
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920339228"
     variation       6746
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1355662531"
     variation       6749
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170784368"
     variation       6750
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:930497110"
     variation       6757
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571385821"
     variation       6760
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645871464"
     variation       6761
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645871530"
     variation       6766
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1290634553"
     variation       6768
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645871697"
     variation       6768
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558270328"
     variation       6769
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211203653"
     variation       6772
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044886782"
     variation       6775
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138767681"
     variation       6778
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:939242447"
     variation       6784
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950401389"
     variation       6787
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185440121"
     variation       6789
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1057145760"
     variation       6791
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645872395"
     variation       6792
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895835109"
     variation       6794..6798
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:1440738836"
     variation       6797
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571385873"
     variation       6806
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:879157668"
     variation       6808
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645872617"
     variation       6816
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645872675"
     variation       6824
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645872766"
     variation       6826
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645872813"
     variation       6829
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645872840"
     variation       6832
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163376199"
     variation       6833
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645872979"
     variation       6834
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:983116176"
     variation       6837
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383722185"
     variation       6838
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908759750"
     variation       6840
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148728950"
     variation       6841
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148728953"
     variation       6842
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540494493"
     variation       6843
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395952822"
     variation       6845
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645873310"
     variation       6849
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:904610426"
     variation       6850
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571385919"
     variation       6853
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148728967"
     variation       6856
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1326832455"
     variation       6859
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371613930"
     variation       6863
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645873813"
     variation       6864
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447359167"
     variation       6865
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:10159166"
     variation       6867
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:953666043"
     variation       6868
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571385961"
     variation       6870
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1344366892"
     variation       6871
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645874205"
     variation       6875
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916104249"
     variation       6877
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645874331"
     variation       6879
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645874374"
     variation       6888
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645874429"
     variation       6889
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373746606"
     variation       6891
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265650361"
     variation       6893
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1009590328"
     variation       6895
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645874686"
     variation       6896
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544844168"
     variation       6902
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571386002"
     variation       6905
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375483845"
     variation       6906
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645874945"
     variation       6907
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1458625794"
     variation       6908
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1019173380"
     variation       6909
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645875109"
     variation       6910
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645875195"
     variation       6912
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1273645163"
     variation       6913
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645875305"
     variation       6916
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165828405"
     variation       6918
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645875441"
     variation       6920
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746073637"
     variation       6921
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645875572"
     variation       6924
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645875655"
     variation       6925
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645875707"
     variation       6927
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1460567228"
     variation       6936
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645875815"
     variation       6937
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645875867"
     variation       6939
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645875920"
     variation       6942
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645875969"
     variation       6944
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645876036"
     variation       6950
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1169758238"
     variation       6951
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:961745768"
     variation       6956
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562192835"
     variation       6957
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1043187507"
     variation       6961
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:904619927"
     variation       6967
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380376895"
     variation       6976
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148729053"
     variation       6986
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645876532"
     variation       6991
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397538632"
     variation       6995
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645876620"
     variation       6998..7000
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1313037150"
     variation       7004
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645876714"
     variation       7005
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487402670"
     variation       7006
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645876817"
     variation       7008
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645876859"
     variation       7010
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:920349220"
     variation       7014
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148729069"
     variation       7017
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645876981"
     variation       7020
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779121299"
     variation       7021
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645877127"
     variation       7025
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148729074"
     variation       7027
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:532756658"
     variation       7031
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645877237"
     variation       7033
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:551094472"
     variation       7039
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645877341"
     variation       7040
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645877397"
     variation       7042
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645877438"
     variation       7043..7044
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1645877485"
     variation       7044
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645877531"
     variation       7046
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1053063998"
     variation       7049
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645877620"
     variation       7060
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371449404"
     variation       7064
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980648055"
     variation       7069
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1317917409"
     variation       7074
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645877810"
     variation       7079
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203660652"
     variation       7082
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645877886"
     variation       7084
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1263954548"
     variation       7084
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645877939"
     variation       7091
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1484473665"
     variation       7092
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182776319"
     variation       7094
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645878184"
     variation       7097
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890351554"
     variation       7098
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748582631"
     variation       7099
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451154583"
     variation       7113
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645878407"
     variation       7115
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1426972330"
     variation       7120
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645878525"
     variation       7123
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571386195"
     variation       7124
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196028282"
     variation       7125
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645878800"
     variation       7127
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1008842113"
     variation       7129
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645878921"
     variation       7132..7137
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="caca"
                     /replace="cacaca"
                     /db_xref="dbSNP:926420699"
     variation       7132
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645878969"
     variation       7147
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1379364534"
     variation       7149
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186734072"
     variation       7155
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755885015"
     variation       7157
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467484723"
     variation       7163
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645879289"
     variation       7165
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:913819772"
     variation       7170..7175
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agc"
                     /replace="agcagc"
                     /db_xref="dbSNP:2148729156"
     variation       7172
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:527357395"
     variation       7173
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:900365728"
     variation       7179
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157779349"
     variation       7181
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:946087269"
     variation       7182
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645879642"
     variation       7184
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378292176"
     variation       7186
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1222356299"
     variation       7189
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645879833"
     variation       7190
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645879888"
     variation       7194
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148729179"
     variation       7195
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:777420444"
     variation       7196
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314501170"
     variation       7197
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645880056"
     variation       7199..7201
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ctc"
                     /db_xref="dbSNP:1645880102"
     variation       7201
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041669384"
     variation       7214
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571386294"
     variation       7215
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645880326"
     variation       7216
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645880377"
     variation       7220
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645880421"
     variation       7225
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645880469"
     variation       7229
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645880596"
     variation       7237
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645880650"
     variation       7248
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1639867973"
     variation       7249
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558373845"
     variation       7250
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904621610"
     variation       7255
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485093351"
     variation       7258
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1219140446"
     variation       7269
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000206497"
     variation       7273
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148729205"
     variation       7274
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772267788"
     variation       7276
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1027366153"
     variation       7279
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197401612"
     variation       7285
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148729212"
     variation       7287
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889305740"
     variation       7288
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749293608"
     variation       7289
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645881473"
     variation       7291
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645881534"
     variation       7307
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1176622861"
     variation       7310
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363083094"
     variation       7312
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:548918631"
     variation       7316
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1019646938"
     variation       7317
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1004521790"
     variation       7323
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324961860"
     variation       7326
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360735202"
     variation       7327
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1333275975"
     variation       7328
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567411609"
     variation       7339
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1369010287"
     variation       7340..7343
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tgta"
                     /replace="tgtatgta"
                     /db_xref="dbSNP:1442309469"
     variation       7341
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1220376437"
     variation       7344
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645882353"
     variation       7345
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770825835"
     variation       7346
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645882492"
     variation       7347
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1027300752"
     variation       7348
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287140063"
     variation       7353..7354
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:1490253808"
     variation       7354
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645882705"
     variation       7357
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:951788921"
     variation       7362
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980959266"
     variation       7367
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1488846783"
     variation       7370
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1352008025"
     variation       7371
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645882980"
     variation       7372
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645883030"
     variation       7374
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1249705353"
     variation       7375
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645883150"
     variation       7380
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544330785"
     variation       7383
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645883275"
     variation       7385
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645883329"
     variation       7387
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413972925"
     variation       7393..7394
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1645883489"
     variation       7393
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:960864590"
     variation       7398
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537750959"
     variation       7400
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:993129847"
     variation       7402
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916062408"
     variation       7403
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351170931"
     variation       7406
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645883831"
     variation       7408
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149237486"
     variation       7410..7414
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ca"
                     /replace="catca"
                     /db_xref="dbSNP:913831161"
     variation       7410..7411
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ca"
                     /replace="cagca"
                     /db_xref="dbSNP:539061324"
     variation       7412
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144443110"
     variation       7413..7435
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cagcagcagca"
                     /replace="cagcagcagcagca"
                     /replace="cagcagcagcagcagca"
                     /replace="cagcagcagcagcagcagca"
                     /replace="cagcagcagcagcagcagcagca"
                     /replace="cagcagcagcagcagcagcagcagca"
                     /replace="cagcagcagcagcagcagcagcagcagca"
                     /replace="cagcagcagcagcagcagcagcagcagcagca"
                     /replace="cagcagcagcagcagcagcagcagcagcagcagca"
                     /db_xref="dbSNP:rs889197162"
     variation       7413
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1355722293"
     variation       7414
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203872063"
     variation       7415
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:575056563"
     variation       7419..7420
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ttgttgt"
                     /db_xref="dbSNP:1269588845"
     variation       7422..7423
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ctatggct"
                     /db_xref="dbSNP:1452072720"
     variation       7424
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1177987270"
     variation       7428
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456405949"
     variation       7431
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cttc"
                     /db_xref="dbSNP:1645885688"
     variation       7431
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645885640"
     variation       7433..7434
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gc"
                     /replace="gcggc"
                     /db_xref="dbSNP:1645885789"
     variation       7433
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180372984"
     variation       7436
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645885837"
     variation       7437
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645885889"
     variation       7441
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645885938"
     variation       7442
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148729327"
     variation       7443
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:934766659"
     regulatory      7449..7454
                     /regulatory_class="polyA_signal_sequence"
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="hexamer: TATAAA"
     variation       7450
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645886069"
     variation       7452..7454
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1645886176"
     variation       7452
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645886118"
     variation       7453
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645886223"
     variation       7455
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:539822482"
     variation       7456
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645886321"
     variation       7458
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645886384"
     variation       7460
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148729344"
     variation       7461
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191490961"
     variation       7462
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645886496"
     variation       7463
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645886526"
     variation       7464
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147996549"
     variation       7469
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534259020"
     variation       7470
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:944611441"
     variation       7471
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571386624"
     variation       7472
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645886834"
     variation       7475
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571386633"
     variation       7476
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1367463573"
     variation       7477
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645887018"
     variation       7478
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:184023415"
     polyA_site      7479
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="major polyA site"
     variation       7483
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574175798"
     variation       7484
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:544618983"
     variation       7486
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571386676"
     variation       7490..7494
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tctct"
                     /db_xref="dbSNP:1645887327"
     variation       7494..7502
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /replace="tttttttttt"
                     /replace="ttttttttttt"
                     /db_xref="dbSNP:rs796351016"
     variation       7500..7501
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:2148729387"
     variation       7501
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645887490"
     variation       7502
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867387436"
     variation       7503
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390866641"
     variation       7510
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571386715"
     variation       7511
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1286216662"
     variation       7512..7515
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:2148729393"
     variation       7512
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188911199"
     variation       7517
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645887831"
     variation       7520
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1214158289"
     variation       7523
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256255072"
     variation       7524
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645887970"
     variation       7528
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645888019"
     variation       7529
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:960456203"
     variation       7533
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645888120"
     variation       7535
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1048938605"
     variation       7537
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182195447"
     variation       7541
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577246142"
     variation       7542
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1645888320"
     variation       7543
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645888365"
     variation       7549
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1004657513"
     variation       7552
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1207790449"
     variation       7567
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1238937216"
     variation       7575
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472929518"
     variation       7579
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645888623"
     variation       7580
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645888676"
     variation       7581
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770258663"
     variation       7585
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645889020"
     variation       7586..7587
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1420923125"
     variation       7586
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1034669992"
     variation       7589
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172080513"
     variation       7595
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:960444785"
     variation       7603..7606
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tcat"
                     /db_xref="dbSNP:1413226399"
     variation       7606
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1336586532"
     variation       7609
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:979339120"
     variation       7613
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430287896"
     variation       7615
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276524536"
     variation       7616
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340047651"
     variation       7617..7618
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:746001460"
     variation       7618
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:925197893"
     variation       7622
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571386829"
     variation       7627
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1267273030"
     variation       7629
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1219290317"
     variation       7632
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645889940"
     variation       7634
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1282674801"
     variation       7639
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645890236"
     variation       7643
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645890277"
     variation       7646
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645890320"
     variation       7650
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344247107"
     variation       7652..7655
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:1645890475"
     variation       7652
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773678037"
     variation       7654
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645890524"
     variation       7655
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1280477276"
     variation       7658
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645890662"
     variation       7659
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1442783041"
     variation       7665
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197921213"
     variation       7666
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:986114472"
     variation       7668
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645890878"
     variation       7670
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645890925"
     variation       7671
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260563689"
     variation       7677
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645891060"
     variation       7686
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645891097"
     variation       7692
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645891142"
     variation       7694
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489008222"
     variation       7695
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763601554"
     variation       7696
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766939124"
     variation       7698
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1477336117"
     variation       7702
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645891407"
     variation       7704
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1178959666"
     variation       7705
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255242825"
     variation       7708
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645891545"
     variation       7709
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1023183515"
     variation       7711
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189238389"
     variation       7722
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645891676"
     variation       7727
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645891738"
     variation       7730
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1296624955"
     variation       7731
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645891932"
     variation       7732
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:970729207"
     variation       7734
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:978931276"
     variation       7738
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185476341"
     variation       7740
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645892133"
     variation       7742
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645892172"
     variation       7745
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645892214"
     variation       7746
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:956112691"
     variation       7747
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477240493"
     variation       7748
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759023126"
     variation       7754
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645892407"
     variation       7755
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302643848"
     variation       7765
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645892494"
     variation       7767..7771
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aatga"
                     /db_xref="dbSNP:2148729521"
     variation       7768
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645892547"
     variation       7769
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:911887757"
     variation       7770
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:898025322"
     variation       7773
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72661620"
     variation       7774
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049380833"
     variation       7778..7780
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gga"
                     /replace="ggagga"
                     /db_xref="dbSNP:1645892854"
     variation       7778..7779
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:764616411"
     variation       7779
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239124372"
     variation       7783..7784
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645892937"
     variation       7787
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1283570239"
     variation       7789
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039451250"
     variation       7793
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:921842803"
     variation       7794
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645893134"
     variation       7796
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355436608"
     variation       7797
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:527401943"
     variation       7800
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467667265"
     variation       7801
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645893334"
     variation       7804..7806
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:71573710"
     variation       7812..7814
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1201704138"
     variation       7814
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645893459"
     variation       7821
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048906465"
     variation       7826
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1299064106"
     variation       7829
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247766098"
     variation       7830
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549014350"
     variation       7832
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1157249630"
     variation       7834
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752455063"
     variation       7839
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645893821"
     variation       7843
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394491176"
     variation       7850
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:888029350"
     variation       7851
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141708021"
     variation       7862..7868
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggag"
                     /replace="ggaggag"
                     /db_xref="dbSNP:1330261261"
     variation       7865
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:896232710"
     variation       7867
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571387090"
     variation       7875
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645894291"
     variation       7879
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571387095"
     variation       7879
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1645894397"
     variation       7885
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645894441"
     variation       7889
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388570987"
     variation       7890
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645894524"
     variation       7894
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1011886579"
     variation       7895
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1325493005"
     variation       7902
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033313595"
     variation       7903
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218020464"
     variation       7909
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1023742547"
     variation       7911
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906099748"
     variation       7914
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:896245769"
     variation       7917
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645895127"
     variation       7918
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013363402"
     variation       7921
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645895229"
     variation       7922
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1353691617"
     variation       7924
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000435153"
     variation       7925
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529304195"
     variation       7926
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542691451"
     variation       7928
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645895540"
     variation       7931
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645895647"
     variation       7931
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:988939718"
     variation       7935
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:979226030"
     variation       7936
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1018993608"
     variation       7940
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645895806"
     variation       7942
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645895843"
     variation       7944
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1183272091"
     variation       7949
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1032227537"
     variation       7950
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11800878"
     variation       7953
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367583172"
     variation       7954
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753609764"
     variation       7955
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465046339"
     variation       7957
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645896209"
     variation       7959
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1329223357"
     variation       7962..7964
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1645896334"
     variation       7962
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645896294"
     variation       7972
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645896399"
     variation       7973
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378916834"
     variation       7974
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190765482"
     variation       7976..7979
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1645896590"
     variation       7976
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311690893"
     variation       7977
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:984738697"
     variation       7979
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148729640"
     variation       7985
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:944691489"
     variation       7994
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148729643"
     variation       7995..7997
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aga"
                     /db_xref="dbSNP:1256497507"
     variation       7995
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1487758792"
     variation       7996
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148729650"
     variation       7999
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645897182"
     variation       8001
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148729652"
     variation       8008
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645897231"
     variation       8009
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976189008"
     variation       8011
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1645897326"
     variation       8016
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1190800512"
     variation       8019
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115528846"
     variation       8020
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197366841"
     variation       8022
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1260527645"
     variation       8027
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:551808585"
     variation       8028
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1200272100"
     variation       8030
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645897780"
     variation       8033
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645897836"
     variation       8036
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645897877"
     variation       8039
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645897924"
     variation       8042
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645897970"
     variation       8044
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1254452984"
     variation       8046
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1425796858"
     variation       8047
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778783444"
     variation       8058..8062
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aca"
                     /replace="acaca"
                     /db_xref="dbSNP:1423093406"
     variation       8059
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645898281"
     variation       8060
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:940472965"
     variation       8064
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1476877414"
     variation       8065
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645898453"
     variation       8067
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049227178"
     variation       8068
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402407879"
     variation       8075
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:909460062"
     variation       8076..8077
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1557630020"
     variation       8076
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1302059480"
     variation       8077
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1571387308"
     variation       8078
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645898841"
     variation       8079
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645898886"
     variation       8082
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147293577"
     variation       8083..8085
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1397482627"
     variation       8083
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645898996"
     variation       8089
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645899069"
     variation       8091
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645899120"
     variation       8092
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645899171"
     variation       8093
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938255812"
     variation       8098
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11263838"
     variation       8100
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645899415"
     variation       8101
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645899471"
     variation       8102
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1216218597"
     variation       8105
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645899572"
     variation       8106
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:663163"
     variation       8107..8108
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ttata"
                     /db_xref="dbSNP:1645899747"
     variation       8108
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645899797"
     variation       8111..8113
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:1645899845"
     variation       8113..8114
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:1013199093"
     variation       8116
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1042160042"
     variation       8122
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645900020"
     variation       8128..8130
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1645900073"
     variation       8128..8129
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:796743131"
     variation       8133
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557630078"
     variation       8138
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645900249"
     variation       8140
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1044725499"
     variation       8141
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645900359"
     variation       8143
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902232968"
     variation       8144
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1557630092"
     variation       8154
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645900525"
     variation       8158..8162
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1645900560"
     variation       8160
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376232788"
     variation       8161..8172
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aagagaa"
                     /replace="aagagaagagaa"
                     /db_xref="dbSNP:1424350327"
     variation       8164
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645900712"
     variation       8165
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1000663554"
     variation       8170
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645900811"
     variation       8176
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032148243"
     variation       8177..8178
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:1645900894"
     variation       8179
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645900937"
     variation       8180
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148729767"
     variation       8181
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:34764544"
     variation       8182
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148729770"
     variation       8183
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:903552001"
     variation       8185
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1000404100"
     variation       8188
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313153284"
     variation       8194..8196
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aaa"
                     /db_xref="dbSNP:1006832383"
     variation       8201
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781125965"
     variation       8205
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645901266"
     variation       8211
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1397696222"
     variation       8212
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748441732"
     variation       8213..8217
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:966105029"
     variation       8213
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:892052895"
     variation       8218
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645901541"
     variation       8224
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1342494143"
     variation       8232
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1314362355"
     variation       8235
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645901702"
     variation       8239
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:919342755"
     variation       8240
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645901799"
     variation       8247
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645901848"
     variation       8254
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1010329201"
     variation       8257..8259
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1557630174"
     variation       8259
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1215065727"
     variation       8260
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769882762"
     variation       8262
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571387463"
     variation       8263
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574185625"
     variation       8264
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1264075715"
     variation       8274
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975260157"
     variation       8276..8282
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttgttt"
                     /db_xref="dbSNP:1645902274"
     variation       8279
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538411096"
     variation       8282
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773731413"
     variation       8283
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:951987747"
     variation       8284
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148729816"
     variation       8285
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645902459"
     variation       8286
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1280795884"
     variation       8287
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148729822"
     variation       8291
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645902565"
     variation       8292
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148729825"
     variation       8297
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265144990"
     variation       8298..8317
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gtaggagaagaaatcagagt"
                     /replace="gtaggagaagaaatcagagtgtaggagaagaaatcagagt"
                     /db_xref="dbSNP:1553157891"
     variation       8302
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645902976"
     variation       8310
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487736618"
     variation       8313
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645903083"
     variation       8314
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749626639"
     variation       8316
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1417491401"
     variation       8316
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:938167185"
     variation       8317
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645903330"
     variation       8318..8325
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agaag"
                     /replace="agaagaag"
                     /db_xref="dbSNP:1160082662"
     variation       8318
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645903375"
     variation       8324
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1345332379"
     variation       8327
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645903513"
     variation       8329
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1214054853"
     variation       8337
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645903616"
     variation       8341
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907765237"
     variation       8345..8351
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaca"
                     /replace="aacaaca"
                     /db_xref="dbSNP:1456950828"
     variation       8346
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645903841"
     variation       8349
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645903885"
     variation       8350
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645903931"
     variation       8353
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148729859"
     variation       8356..8357
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:371771654"
     variation       8359
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571387555"
     variation       8360
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645904086"
     variation       8363..8368
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agag"
                     /replace="agagag"
                     /db_xref="dbSNP:1645904193"
     variation       8363
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645904133"
     variation       8365
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556310027"
     variation       8373..8374
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1264683629"
     variation       8374..8376
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:2148729868"
     variation       8374
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645904356"
     variation       8376..8384
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /replace="tttttttttt"
                     /db_xref="dbSNP:557690955"
     variation       8379
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:577932548"
     variation       8380
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645904533"
     variation       8382
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187611390"
     variation       8383
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1267197074"
     variation       8384..8386
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:1491398912"
     variation       8384
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645904691"
     variation       8385
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:375747906"
     variation       8385
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1431961690"
     variation       8386..8392
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tgtgt"
                     /replace="tgtgtgt"
                     /db_xref="dbSNP:949060752"
     variation       8387
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771565242"
     variation       8388
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645905040"
     variation       8389
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1396098897"
     variation       8391
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1419295127"
     variation       8392..8401
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="ttttaccttt"
                     /db_xref="dbSNP:1645905198"
     variation       8396
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645905238"
     variation       8398
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1042002877"
     variation       8404
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645905349"
     variation       8405
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1286980669"
     variation       8406
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321236834"
     variation       8410
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645905480"
     variation       8418
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645905516"
     variation       8420
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1219505196"
     variation       8421
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571387653"
     variation       8423
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1267249623"
     variation       8425
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369684987"
     variation       8430
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645905767"
     variation       8431..8434
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1194112655"
     variation       8434..8436
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tat"
                     /db_xref="dbSNP:1237414549"
     variation       8434
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1645905861"
     variation       8437..8448
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gacttacttacg"
                     /db_xref="dbSNP:1645905983"
     variation       8438..8447
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="acttac"
                     /replace="acttacttac"
                     /db_xref="dbSNP:750086957"
     variation       8438
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645906029"
     variation       8441
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:917773706"
     variation       8442
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645906224"
     variation       8442
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645906185"
     variation       8446
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1362524771"
     variation       8447
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645906455"
     variation       8447
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61555210"
     variation       8448
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293016194"
     variation       8449
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774945280"
     variation       8459
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1045258462"
     variation       8468
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1351045545"
     variation       8472
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645906718"
     variation       8473
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571387722"
     variation       8474
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565480687"
     variation       8475
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182177708"
     variation       8479
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331242413"
     variation       8486
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645906985"
     variation       8488
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:572003492"
     variation       8493
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398619650"
     variation       8496..8499
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:754918941"
     variation       8498
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280462375"
     variation       8502
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:936305098"
     variation       8505
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226766659"
     variation       8507
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1052060548"
     variation       8515
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1352780824"
     variation       8519
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:892022079"
     variation       8520
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314948396"
     variation       8523
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542039100"
     variation       8525..8530
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cac"
                     /replace="caccac"
                     /db_xref="dbSNP:1645907567"
     variation       8526
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645907624"
     variation       8527
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645907679"
     variation       8532
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645907731"
     variation       8533
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571387811"
     variation       8539
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1040534105"
     variation       8542
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902042514"
     variation       8545
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645907910"
     variation       8553
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645907960"
     variation       8555
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645908010"
     variation       8557
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571387839"
     variation       8561
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645908075"
     variation       8563..8568
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aataaa"
                     /db_xref="dbSNP:1317146102"
     variation       8566..8574
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaac"
                     /replace="aaacaaaac"
                     /db_xref="dbSNP:997523767"
     variation       8570
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767123720"
     variation       8573
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571387863"
     variation       8578
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571387867"
     variation       8583
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645908405"
     variation       8585..8592
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tcctagcc"
                     /db_xref="dbSNP:1645908448"
     variation       8591
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645908497"
     variation       8594
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aatatta"
                     /db_xref="dbSNP:1645908602"
     variation       8594
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029459149"
     variation       8600
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571387884"
     variation       8601
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774834541"
     variation       8610
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645908777"
     variation       8611..8612
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1645908887"
     variation       8611
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645908816"
     variation       8612
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1233198421"
     variation       8613
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645908978"
     variation       8614
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645909028"
     variation       8616
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148730012"
     variation       8621
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645909071"
     variation       8627..8632
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tag"
                     /replace="tagtag"
                     /db_xref="dbSNP:1645909107"
     variation       8631
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645909150"
     variation       8639
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762839218"
     variation       8640..8648
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tattt"
                     /replace="tatttattt"
                     /db_xref="dbSNP:1179746891"
     variation       8641
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645909344"
     variation       8645..8646
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="at"
                     /replace="ataat"
                     /db_xref="dbSNP:1263195438"
     variation       8650
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645909441"
     variation       8651
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475235403"
     variation       8652
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645909532"
     variation       8653
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645909578"
     variation       8654
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645909620"
     variation       8656
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006202972"
     variation       8659..8665
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tctt"
                     /replace="tcttctt"
                     /db_xref="dbSNP:1170643933"
     variation       8663
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645909760"
     variation       8664
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571387944"
     variation       8667
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422145745"
     variation       8674
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375451995"
     variation       8679
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645909930"
     variation       8693
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1014957927"
     variation       8696..8700
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tat"
                     /replace="tatat"
                     /db_xref="dbSNP:909283444"
     variation       8697
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961944436"
     variation       8702
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1196097951"
     variation       8703
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645910202"
     variation       8703
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645910166"
     variation       8706
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645910251"
     variation       8709
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253996075"
     variation       8711
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:992521972"
     variation       8712
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645910417"
     variation       8718
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645910458"
     variation       8719
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645910515"
     variation       8721
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991359427"
     variation       8722..8723
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1645910622"
     variation       8724
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:917757843"
     variation       8725
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:969590169"
     variation       8727
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218063131"
     variation       8730
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439531364"
     variation       8735
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645911357"
     variation       8739
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1557630522"
     variation       8740
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980636381"
     variation       8741
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316018304"
     variation       8745
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645911565"
     variation       8746
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:925003738"
     variation       8749
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645911655"
     variation       8750
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176998308"
     variation       8755
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645911744"
     variation       8756
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:936440744"
     variation       8757
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645911840"
     variation       8762
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645911885"
     variation       8765
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216184695"
     variation       8773..8774
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1645911975"
     variation       8775
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1273527169"
     variation       8776
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645912066"
     variation       8777
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645912107"
     variation       8779
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645912153"
     variation       8783
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1441615560"
     variation       8784..8787
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:1207643714"
     variation       8785
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918185284"
     variation       8786
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485770805"
     variation       8792
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192327329"
     variation       8795
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:949611226"
     variation       8799
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1479091509"
     variation       8800
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977746888"
     variation       8801
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645912933"
     variation       8802
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1168993980"
     variation       8806
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401515206"
     variation       8811
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645913138"
     variation       8812
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571388106"
     variation       8814
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645913242"
     variation       8820
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:923632669"
     variation       8823
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178558224"
     variation       8827
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645913385"
     variation       8832
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:185191307"
     variation       8833
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1348252754"
     variation       8838
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645913563"
     variation       8841
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645913592"
     variation       8846
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1459362590"
     variation       8854
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:913598862"
     variation       8858
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1296441105"
     variation       8861
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255355390"
     variation       8863
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1053574204"
     variation       8872
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645914337"
     variation       8880..8881
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tacatta"
                     /db_xref="dbSNP:1645914441"
     variation       8880
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1645914395"
     variation       8881
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:946293747"
     variation       8882
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cattatc"
                     /db_xref="dbSNP:1645914549"
     variation       8884
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645914597"
     variation       8888
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148730137"
     variation       8891
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645914643"
     variation       8892
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571388164"
     variation       8896
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1344082505"
     variation       8898
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041064870"
     variation       8899
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645914949"
     variation       8907
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148730146"
     variation       8908
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902102576"
     variation       8913
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348171002"
     variation       8916
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041242279"
     variation       8921
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260498192"
     variation       8927
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645915204"
     variation       8931
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1488977942"
     variation       8933
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:996721403"
     variation       8935
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246608446"
     variation       8941
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645915401"
     variation       8947
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050633707"
     variation       8951
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645915497"
     variation       8952..8958
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tggt"
                     /replace="tggtggt"
                     /db_xref="dbSNP:1645915544"
     variation       8954
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372984594"
     variation       8957
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1193311041"
     variation       8958
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311204694"
     variation       8962
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645915762"
     variation       8967
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557630747"
     variation       8969
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571388234"
     variation       8972
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760427087"
     variation       8980
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025546631"
     variation       8983
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1419395934"
     variation       8985
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561018703"
     variation       8992..8993
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1645916191"
     variation       8994
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1362587577"
     variation       9002
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645916291"
     variation       9004
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645916333"
     variation       9010..9020
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="ttgttatttct"
                     /db_xref="dbSNP:886475700"
     variation       9014
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763687211"
     variation       9016
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016353899"
     variation       9021
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:531279755"
     variation       9033
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:959688040"
     variation       9042
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645916654"
     variation       9043
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645916697"
     variation       9052
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645916781"
     variation       9058
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962078524"
     variation       9059
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868779519"
     variation       9061
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645917001"
     variation       9063
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571388284"
     variation       9064
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1239056012"
     variation       9066
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645917148"
     variation       9067
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645917198"
     variation       9069
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1025076280"
     variation       9071
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1287091044"
     variation       9078
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645917377"
     variation       9079
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645917438"
     variation       9083
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645917492"
     variation       9084
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645917535"
     variation       9090
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1323048375"
     variation       9091
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645917625"
     variation       9093
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645917669"
     variation       9097
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645917718"
     variation       9101
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645917769"
     variation       9104
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645917834"
     variation       9105
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013592131"
     variation       9108
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1025276256"
     variation       9111
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645918010"
     variation       9113
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645918050"
     variation       9115
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1645918116"
     variation       9117..9123
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="ttcctct"
                     /db_xref="dbSNP:1645918165"
     variation       9122
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:969343335"
     variation       9123..9138
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tg"
                     /replace="tggaggccaagtgttg"
                     /db_xref="dbSNP:531097561"
     variation       9125
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645918352"
     variation       9132
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288469844"
     variation       9138
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457711634"
     variation       9143
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924187437"
     variation       9144
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:936380126"
     variation       9146
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645918640"
     variation       9148
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439445401"
     variation       9149
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980987145"
     variation       9154
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188289018"
     variation       9155
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645918843"
     variation       9156
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645918909"
     variation       9158
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1470605990"
     variation       9163
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375321641"
     variation       9171..9173
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1234983001"
     variation       9173
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645919134"
     variation       9174
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645919188"
     variation       9175
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1403601243"
     variation       9180
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1327825640"
     variation       9181
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:910981528"
     variation       9182
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645919439"
     variation       9183..9194
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agccagccagcc"
                     /replace="agccagccagccagcc"
                     /db_xref="dbSNP:1181550295"
     variation       9184
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411707007"
     variation       9186
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557630912"
     variation       9189
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:957770044"
     variation       9191
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645919705"
     variation       9193
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942413140"
     variation       9195
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337188989"
     variation       9197
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1040900849"
     variation       9200..9205
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctt"
                     /replace="cttctt"
                     /db_xref="dbSNP:1645919966"
     variation       9202
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1283098745"
     variation       9203
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645920093"
     variation       9207
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148730297"
     variation       9208
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353624234"
     variation       9213
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1476268804"
     variation       9217
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:901028900"
     variation       9221
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457678064"
     variation       9231
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645920365"
     variation       9233
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197180703"
     variation       9241..9245
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ga"
                     /replace="gaaga"
                     /replace="gaagaaga"
                     /db_xref="dbSNP:140864"
     variation       9241
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645920503"
     variation       9242..9243
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:34307163"
     variation       9243..9246
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:35814364"
     variation       9243..9244
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="ga"
                     /db_xref="dbSNP:869263455"
     variation       9243
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201441860"
     variation       9247
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:550020187"
     variation       9249
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1438623533"
     variation       9250
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047055048"
     variation       9251
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:888328294"
     variation       9259
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645921198"
     variation       9260
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148730337"
     variation       9264
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1006231276"
     variation       9272
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645921275"
     variation       9274
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645921336"
     variation       9277
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181116037"
     variation       9279
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645921436"
     variation       9281
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1167074194"
     variation       9282
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333074315"
     variation       9284..9285
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645921609"
     variation       9285
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645921660"
     variation       9286
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1016651001"
     variation       9287
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645921779"
     variation       9289..9291
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="ata"
                     /db_xref="dbSNP:555724154"
     variation       9289
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756987293"
     variation       9290
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645921958"
     variation       9295
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571388519"
     variation       9297
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557631025"
     variation       9301
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1012769642"
     variation       9302
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148730355"
     variation       9303..9304
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:2148730356"
     variation       9304
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987884081"
     variation       9305
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391670109"
     variation       9311
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550717064"
     variation       9312
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1025002346"
     variation       9318
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333064396"
     variation       9319
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148730365"
     variation       9320..9325
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaagaa"
                     /db_xref="dbSNP:1645922504"
     variation       9320
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:970904019"
     variation       9322
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148730371"
     variation       9323
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1338243940"
     variation       9328
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148730372"
     variation       9329..9333
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="agcag"
                     /db_xref="dbSNP:978227204"
     variation       9331
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645922642"
     variation       9333..9337
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1557631060"
     variation       9334
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645922737"
     variation       9336
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115162190"
     variation       9337
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557631064"
     variation       9338..9339
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1557631076"
     variation       9338
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1557631071"
     variation       9340
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645922998"
     variation       9341..9350
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aggagga"
                     /replace="aggaggagga"
                     /db_xref="dbSNP:1645923047"
     variation       9348
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1317848508"
     variation       9349
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645923174"
     variation       9351
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:958496568"
     variation       9353
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1253510461"
     variation       9355
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:943662728"
     variation       9356
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547713014"
     variation       9357
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1233292745"
     variation       9364
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645923581"
     variation       9367
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645923620"
     variation       9368
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645923674"
     variation       9370
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976459592"
     variation       9371
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645923769"
     variation       9372
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645923803"
     variation       9373
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1188783541"
     variation       9379
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645923894"
     variation       9380
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369522490"
     variation       9385
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645923987"
     variation       9390
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:923494918"
     variation       9391
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1477460562"
     variation       9392
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1317790452"
     variation       9395..9396
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:1645924240"
     variation       9395
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645924190"
     variation       9397
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369678188"
     variation       9399
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1645924382"
     variation       9399
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645924334"
     variation       9400
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750425416"
     variation       9402
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:932276397"
     variation       9406
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1399655616"
     variation       9412
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645924654"
     variation       9412
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645924616"
     variation       9414
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:910853352"
     variation       9419
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148730433"
     variation       9420
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536927360"
     variation       9422
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566794455"
     variation       9425..9426
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:1645924872"
     variation       9426
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645924925"
     variation       9433
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645924976"
     variation       9434
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339261076"
     variation       9436
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1209679291"
     variation       9437..9443
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aagttaa"
                     /db_xref="dbSNP:1645925240"
     variation       9437
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942092258"
     variation       9441
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645925297"
     variation       9442
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645925351"
     variation       9446
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1233011649"
     variation       9447
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645925450"
     variation       9452
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235883822"
     variation       9456
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557631171"
     variation       9459
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1254587948"
     variation       9460
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:963726070"
     variation       9461
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645925755"
     variation       9462
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1211791579"
     variation       9464
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645925844"
     variation       9465
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645925905"
     variation       9468
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:976524051"
     variation       9469
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1285469149"
     variation       9471
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645926152"
     variation       9472
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487344556"
     variation       9475
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:922346450"
     variation       9478
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:929800092"
     variation       9481
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:527669622"
     variation       9482
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549237039"
     variation       9484
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197914771"
     variation       9486
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148730478"
     variation       9489
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1392976578"
     variation       9491
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436265888"
     variation       9503
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173872939"
     variation       9504
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1359389680"
     variation       9510
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450967468"
     variation       9511
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1290064103"
     variation       9512
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781379128"
     variation       9513
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909814849"
     variation       9515
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299657367"
     variation       9517
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1373626613"
     variation       9522
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645927187"
     variation       9525
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185858553"
     variation       9541
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1055697473"
     variation       9543
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72661621"
     variation       9544..9553
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tccttc"
                     /replace="tccttccttc"
                     /db_xref="dbSNP:1218081256"
     variation       9544
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645927931"
     variation       9545
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261319218"
     variation       9547
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557631281"
     variation       9550
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905089140"
     variation       9554
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645928288"
     variation       9556
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476784105"
     variation       9558
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645928392"
     variation       9559
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1209153186"
     variation       9560
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1002154199"
     variation       9564
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250980066"
     variation       9566
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148730511"
     variation       9583
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148730512"
     variation       9590
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571388910"
     variation       9601
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645928633"
     variation       9605
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645928670"
     variation       9607
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645928707"
     variation       9611
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1169625706"
     variation       9612
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557631302"
     variation       9616
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645928858"
     variation       9617
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645928897"
     variation       9618
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755404281"
     variation       9621
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1379326027"
     variation       9624
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:566124661"
     variation       9630
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906587405"
     variation       9631
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645929464"
     variation       9635
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:957905671"
     variation       9636
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987936386"
     variation       9639..9643
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tct"
                     /replace="tctct"
                     /db_xref="dbSNP:1324462378"
     variation       9640
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645929665"
     variation       9643
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1397188131"
     variation       9644
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645929760"
     variation       9646
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1442134509"
     variation       9648
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308942244"
     variation       9650..9661
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="agcagaccccag"
                     /db_xref="dbSNP:1645929927"
     variation       9652
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571388998"
     variation       9656
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1020633272"
     variation       9657
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645930068"
     variation       9658
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:537918276"
     variation       9659
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011597209"
     variation       9661
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645930333"
     variation       9663
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976807461"
     variation       9665
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1415042054"
     variation       9669
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556344781"
     variation       9671
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645930529"
     variation       9672
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645930579"
     variation       9674
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645930630"
     variation       9676
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645930675"
     variation       9687
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645930721"
     variation       9694
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920968850"
     variation       9695
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:571457484"
     variation       9696
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1237268495"
     variation       9698..9701
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:1479460493"
     variation       9703
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178560312"
     variation       9706
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645931081"
     variation       9708
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408159161"
     variation       9710
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422693027"
     variation       9712
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778071525"
     variation       9719
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:538991257"
     variation       9722
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645931359"
     variation       9724
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1420696197"
     variation       9731
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1462365726"
     variation       9732
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337824283"
     variation       9734
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:976378557"
     variation       9740..9742
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1353108129"
     variation       9741
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645931650"
     variation       9743
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:76228984"
     variation       9752
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645931822"
     variation       9754
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148730618"
     variation       9755
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:909469542"
     variation       9757
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982632384"
     variation       9758
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645932004"
     variation       9763
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571389116"
     variation       9764
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645932124"
     variation       9765
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1413035460"
     variation       9767
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645932222"
     variation       9768
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909731645"
     variation       9770
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645932343"
     variation       9773
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645932401"
     variation       9776
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1336859435"
     variation       9778
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645932525"
     variation       9779
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:941191309"
     variation       9784
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571976877"
     variation       9786
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542631707"
     variation       9787
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554236559"
     variation       9789
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645932802"
     variation       9793
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218947869"
     variation       9794
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1276981531"
     variation       9805
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206225660"
     variation       9806
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:897878642"
     variation       9807
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949518256"
     variation       9808
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:76697094"
     variation       9810
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1185171901"
     variation       9811
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258936672"
     variation       9814
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1645933368"
     variation       9815
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1475855058"
     variation       9816..9817
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1170589272"
     variation       9817
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:2148730672"
     variation       9817
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645933797"
     variation       9818
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417868148"
     variation       9819
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571389218"
     variation       9823
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:905225551"
     variation       9829
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002072883"
     variation       9838
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487381167"
     variation       9840
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645934129"
     variation       9841
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1171506019"
     variation       9842
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645934252"
     variation       9844
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645934296"
     variation       9845
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191561832"
     variation       9848
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:565124454"
     variation       9851
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645934495"
     variation       9860
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356152831"
     variation       9862
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645934617"
     variation       9868
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242561591"
     variation       9869
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774855156"
     variation       9870
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020767569"
     variation       9871
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645934928"
     variation       9883
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396694608"
     variation       9884
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965488511"
     variation       9885
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:999541063"
     variation       9886..9887
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1273371065"
     variation       9886
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052452213"
     variation       9889
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1208267090"
     variation       9891
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645935320"
     variation       9892
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1281928751"
     variation       9894
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645935416"
     variation       9899
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:997980288"
     variation       9907
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645935522"
     variation       9915
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144839878"
     variation       9917
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645935647"
     variation       9923
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953699800"
     variation       9931
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777902193"
     variation       9938
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645935888"
     variation       9939
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571389337"
     variation       9940
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:909436967"
     variation       9944
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645936024"
     variation       9950
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148730732"
     variation       9951
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645936070"
     variation       9954
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746430497"
     variation       9956
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:972205965"
     variation       9958
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645936224"
     variation       9959
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1424826706"
     variation       9961
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1433155202"
     variation       9965
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645936346"
     variation       9966
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645936384"
     variation       9971
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299430009"
     variation       9978
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645936481"
     variation       9983
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:964296465"
     variation       9984
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645936637"
     variation       9984
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:541373139"
     variation       9985
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567471178"
     variation       9986
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046513851"
     variation       9989
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645936800"
     variation       9991
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645936844"
     variation       9992
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:926702492"
     variation       9994
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645936923"
     variation       9995
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343372432"
     variation       9998
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937979601"
     variation       10000
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645937054"
     variation       10002
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645937090"
     variation       10004..10012
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ta"
                     /replace="tatatcata"
                     /db_xref="dbSNP:1645937128"
     variation       10005
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772438156"
     variation       10009
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1273415719"
     variation       10010
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645937280"
     variation       10012
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:951009828"
     variation       10015..10016
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645937390"
     variation       10016
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1369976515"
     variation       10017
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645937485"
     variation       10019..10024
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:1373713883"
     variation       10024
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183777566"
     variation       10029
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235279035"
     variation       10031
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:893706036"
     variation       10032
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645938031"
     variation       10035
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:879287028"
     variation       10036
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645938135"
     variation       10037
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645938178"
     variation       10039
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645938223"
     variation       10040
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571389448"
     variation       10041
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376685024"
     variation       10042
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285655950"
     variation       10043
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1557631682"
     variation       10046
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1009468975"
     variation       10049
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775089595"
     variation       10051
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645938531"
     variation       10052
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645938581"
     variation       10053
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351784476"
     variation       10055
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645938762"
     variation       10057
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982558756"
     variation       10058
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1042607221"
     variation       10059
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645938928"
     variation       10062
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645938968"
     variation       10064..10070
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tgtt"
                     /replace="tgttgtt"
                     /db_xref="dbSNP:1449247484"
     variation       10068
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450922295"
     variation       10078
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645939126"
     variation       10081
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1246555874"
     variation       10082
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645939234"
     variation       10084
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452924763"
     variation       10086
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186821250"
     variation       10088
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645939409"
     variation       10090
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147529833"
     variation       10092
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1571389520"
     variation       10094
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645939650"
     variation       10100
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645939724"
     variation       10103
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:901047433"
     variation       10104
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645940116"
     variation       10105
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645940165"
     variation       10106
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1016676335"
     variation       10107
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571389534"
     variation       10111..10116
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:1156913272"
     variation       10112
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1454602683"
     variation       10117
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1041723286"
     variation       10120
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1402447345"
     variation       10121..10124
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1378038090"
     variation       10121
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:902424416"
     variation       10123..10124
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /replace="ttt"
                     /db_xref="dbSNP:1455044342"
     variation       10123
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1393521931"
     variation       10124
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237809139"
     variation       10125..10143
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tttttttttt"
                     /replace="ttttttttttttt"
                     /replace="ttttttttttttttt"
                     /replace="tttttttttttttttt"
                     /replace="ttttttttttttttttt"
                     /replace="tttttttttttttttttt"
                     /replace="ttttttttttttttttttt"
                     /replace="tttttttttttttttttttt"
                     /replace="ttttttttttttttttttttt"
                     /replace="tttttttttttttttttttttt"
                     /replace="ttttttttttttttttttttttt"
                     /replace="tttttttttttttttttttttttttttttttttt"
                     /replace="tttttttttttttttttttttttttttttttttttttttttttttttt
                     ttttttt"
                     /db_xref="dbSNP:rs56299314"
     variation       10125
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:998430886"
     variation       10126
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389444371"
     variation       10127..10128
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1253963572"
     variation       10127
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:991298321"
     variation       10128..10129
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1645941577"
     variation       10128
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645941528"
     variation       10129
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645941619"
     variation       10130
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1305799231"
     variation       10131
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1437526799"
     variation       10132..10133
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1645941836"
     variation       10132
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1324541265"
     variation       10133
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645941887"
     variation       10135
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1373639324"
     variation       10138
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442010437"
     variation       10142..10143
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645942085"
     variation       10143
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:915821854"
     variation       10144..10145
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1459750847"
     variation       10144
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1334151702"
     variation       10145
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645942678"
     variation       10146
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1645942899"
     variation       10146
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1241485762"
     variation       10147
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148730886"
     variation       10151
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148730888"
     variation       10153..10161
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ataata"
                     /replace="ataataata"
                     /db_xref="dbSNP:1390527072"
     variation       10162
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1326405001"
     variation       10164
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148730897"
     variation       10169
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571389709"
     variation       10170
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571389716"
     variation       10172
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148730909"
     variation       10175
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192178564"
     variation       10180
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76010229"
     variation       10181
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292086954"
     variation       10183
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148730920"
     variation       10188
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645943470"
     variation       10189
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333357254"
     variation       10191
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368787742"
     variation       10192
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645943653"
     variation       10195
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274276173"
     variation       10196
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1339109894"
     variation       10202
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1274900715"
     variation       10206
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:571547232"
     variation       10209
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645943980"
     variation       10215
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571389776"
     variation       10217
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438572134"
     variation       10222
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557631973"
     variation       10224..10228
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tc"
                     /replace="tcctc"
                     /db_xref="dbSNP:1645944220"
     variation       10224
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468870902"
     variation       10225
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927991002"
     variation       10226
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645944341"
     variation       10229
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645944393"
     variation       10232
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645944429"
     variation       10234..10238
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:2148730948"
     variation       10237
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1197725041"
     variation       10239
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148730952"
     variation       10241
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571389812"
     variation       10242
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:953944035"
     variation       10247
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1236172183"
     variation       10248
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645944711"
     variation       10249..10252
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:935320290"
     variation       10251
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645944817"
     variation       10252
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645944852"
     variation       10256
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645944915"
     variation       10257
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005197104"
     variation       10258
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1418357887"
     variation       10261
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645945036"
     variation       10267
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052981048"
     variation       10269
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165885221"
     variation       10274
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645945167"
     variation       10276
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:893885209"
     variation       10280
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538830586"
     variation       10283
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:554046305"
     variation       10286..10290
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aatga"
                     /db_xref="dbSNP:1039846959"
     variation       10288
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417210514"
     variation       10291..10297
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gag"
                     /replace="gagtgag"
                     /db_xref="dbSNP:1166468590"
     variation       10291
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645945523"
     variation       10300
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397247151"
     variation       10302
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1016631003"
     variation       10307
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79355955"
     variation       10312
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374567306"
     variation       10314
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:998463302"
     variation       10315..10323
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gtttg"
                     /replace="gtttgtttg"
                     /db_xref="dbSNP:1645945883"
     variation       10317
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1253380792"
     variation       10318
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645945999"
     variation       10319
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:972340698"
     variation       10328
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1210421637"
     variation       10329
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278367992"
     variation       10333..10337
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aagta"
                     /db_xref="dbSNP:1645946188"
     variation       10334
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486676421"
     variation       10341
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148730998"
     variation       10346
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029907759"
     variation       10347
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256800555"
     variation       10350..10353
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tttt"
                     /db_xref="dbSNP:1427805956"
     variation       10355
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1190759460"
     variation       10357
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331051161"
     variation       10361
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886809352"
     variation       10362..10364
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:2148731008"
     variation       10363
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449770932"
     variation       10366
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645946697"
     variation       10367
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571389968"
     variation       10373
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1172599437"
     variation       10374
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537611630"
     variation       10376
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393337895"
     variation       10379
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1017098420"
     variation       10381
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1329859133"
     variation       10382
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962457507"
     variation       10392
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298262217"
     variation       10393
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645947152"
     variation       10397
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:970880807"
     variation       10398
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:796216640"
     variation       10401
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:991745125"
     variation       10402
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1022772857"
     variation       10407
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926698779"
     variation       10408
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1211717696"
     variation       10411
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765055734"
     variation       10415
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645947544"
     variation       10416
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231469789"
     variation       10420
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645947772"
     variation       10423
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:938122072"
     variation       10425
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645947863"
     variation       10426
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645947901"
     variation       10427
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:536504767"
     variation       10432
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645948019"
     variation       10433
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645948072"
     variation       10436
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1263636608"
     variation       10440
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750161490"
     variation       10442
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645948761"
     variation       10446
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645948795"
     variation       10447
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1192727380"
     variation       10449
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645948898"
     variation       10451
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557632206"
     variation       10454
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645948999"
     variation       10460
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645949043"
     variation       10461..10467
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aagaaaa"
                     /db_xref="dbSNP:1392914826"
     variation       10461
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645949105"
     variation       10468
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645949205"
     variation       10469
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:981350706"
     variation       10470
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455253259"
     variation       10471..10479
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tcat"
                     /replace="tcatttcat"
                     /db_xref="dbSNP:924520841"
     variation       10475
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:915277531"
     variation       10477
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645949519"
     variation       10478
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1452338087"
     variation       10480
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645949661"
     variation       10481
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217983159"
     variation       10486
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291110926"
     variation       10489
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645949803"
     variation       10491
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536507609"
     variation       10494
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1389902328"
     variation       10495
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440655487"
     variation       10498
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645949979"
     variation       10499
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:555810167"
     variation       10504
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1042270233"
     variation       10512
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645950154"
     variation       10514
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:901095268"
     variation       10519..10524
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttaatt"
                     /db_xref="dbSNP:1306471992"
     variation       10520
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998002982"
     variation       10530
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554734378"
     variation       10532
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645950403"
     variation       10533
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262448321"
     variation       10534
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:889519470"
     variation       10537
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645950528"
     variation       10539
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:761407670"
     variation       10541
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1005332944"
     variation       10542
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645950670"
     variation       10543
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465261319"
     variation       10544
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574671804"
     variation       10549
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645950821"
     variation       10553..10554
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:765710979"
     variation       10553
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:554554773"
     variation       10562
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575943703"
     variation       10564
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645951006"
     variation       10566
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543584812"
     variation       10568
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440347734"
     variation       10572
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645951162"
     variation       10574
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249253610"
     variation       10577
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1416767433"
     variation       10579
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:946799865"
     variation       10580
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1040176474"
     variation       10581
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645951426"
     variation       10582
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1571390306"
     variation       10585
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766182338"
     variation       10588
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645951578"
     variation       10591
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645951627"
     variation       10597
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:994240347"
     variation       10601
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1026532078"
     variation       10602
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:564774699"
     variation       10603
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645951847"
     variation       10609
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:934140536"
     variation       10610
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532140374"
     variation       10611
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645952015"
     variation       10612
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1397122822"
     variation       10615
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752823385"
     variation       10618
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645952175"
     variation       10624
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475802643"
     variation       10627
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769579976"
     variation       10629
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051385703"
     variation       10633
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1387279727"
     variation       10634
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:887318250"
     variation       10636
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577137923"
     variation       10642
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148731147"
     variation       10644
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645952594"
     variation       10646
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571390376"
     variation       10647
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645952695"
     variation       10649
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645952755"
     variation       10653
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571390379"
     variation       10661
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1329790878"
     variation       10662
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1232591929"
     variation       10664
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645952994"
     variation       10665
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016571419"
     variation       10666
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541247710"
     variation       10669
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1221909151"
     variation       10672
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645953212"
     variation       10675..10678
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1250436182"
     variation       10676
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170656511"
     variation       10681
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645953349"
     variation       10684
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1012690951"
     variation       10687
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148731173"
     variation       10694
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1034292694"
     variation       10696
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1023122358"
     variation       10698
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645953543"
     variation       10699
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1475198673"
     variation       10701
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645953620"
     variation       10703
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:959441747"
     variation       10704
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645953732"
     variation       10708
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971236523"
     variation       10716
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406344392"
     variation       10717
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571390465"
     variation       10718
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148731193"
     variation       10722..10725
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:1170144354"
     variation       10722
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756201441"
     variation       10723
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571390483"
     variation       10724
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645954035"
     variation       10727
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463669362"
     variation       10731
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308776284"
     variation       10732
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645954194"
     variation       10733
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645954239"
     variation       10737
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:797000"
     variation       10739
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1413202362"
     variation       10740
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1314800058"
     variation       10743
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1356235775"
     variation       10744
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645954749"
     variation       10744
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291336086"
     variation       10745
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399312246"
     variation       10748
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381191391"
     variation       10751
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645954902"
     variation       10753
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293434777"
     variation       10757
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645955000"
     variation       10773
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645955058"
     variation       10775
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1271937511"
     variation       10782
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1305415314"
     variation       10787
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645955199"
     variation       10788
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149973488"
     variation       10789
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645955307"
     variation       10791
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274815717"
     variation       10797
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978512280"
     variation       10801
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1485047376"
     variation       10805..10810
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="atc"
                     /replace="atcatc"
                     /db_xref="dbSNP:988567911"
     variation       10807..10814
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="catc"
                     /replace="catccatc"
                     /db_xref="dbSNP:1645955559"
     variation       10808
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645955621"
     variation       10809
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645955670"
     variation       10812
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260272129"
     variation       10818
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148731236"
     variation       10819
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473376114"
     variation       10822..10823
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="gc"
                     /db_xref="dbSNP:1645955865"
     variation       10824..10831
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tta"
                     /replace="ttagatta"
                     /db_xref="dbSNP:915270251"
     variation       10826
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1417796906"
     variation       10834
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148731249"
     variation       10836
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645956028"
     variation       10837
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645956083"
     variation       10840
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922523004"
     variation       10850
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:933923210"
     variation       10851
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049564838"
     variation       10854
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255212265"
     variation       10859
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571390632"
     variation       10862
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345239585"
     variation       10867
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645956465"
     variation       10868
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1374976353"
     variation       10870
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645956563"
     variation       10872
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645956616"
     variation       10876
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645956654"
     variation       10884
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645956696"
     variation       10890
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645956744"
     variation       10893
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1432963371"
     variation       10899
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557632608"
     variation       10901
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645956893"
     variation       10904
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148731274"
     variation       10906
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645956933"
     variation       10907
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645956974"
     variation       10910
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749591113"
     variation       10911
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645957080"
     variation       10918
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645957267"
     variation       10919
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314784229"
     variation       10929
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541709462"
     variation       10932
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645957439"
     variation       10933
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645957482"
     variation       10934
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360833545"
     variation       10937
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:889656691"
     variation       10938
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:975558464"
     variation       10940
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1269434140"
     variation       10941
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645957713"
     variation       10944
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941085179"
     variation       10946
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645957762"
     variation       10947
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370987082"
     variation       10951
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645957861"
     variation       10957
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1557632654"
     variation       10958
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:561377490"
     variation       10959
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645958029"
     variation       10961
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645958078"
     variation       10966..10969
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:1212627138"
     variation       10968
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645958200"
     variation       10970
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1230227545"
     variation       10977
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1557632676"
     variation       10978
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1038086877"
     variation       10979
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645958411"
     variation       10985
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1297912830"
     variation       10987
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1346659954"
     variation       10988
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231450945"
     variation       10990
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896914475"
     variation       10993
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1281771883"
     variation       10996..11001
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agag"
                     /replace="agagag"
                     /db_xref="dbSNP:1645958717"
     variation       11004
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645958777"
     variation       11009
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1257578153"
     variation       11011
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1215700811"
     variation       11016
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:531586139"
     variation       11017
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645958969"
     variation       11019
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757525458"
     variation       11020
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487708249"
     variation       11026
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1487039969"
     variation       11034
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571390780"
     variation       11036
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72902981"
     variation       11039
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260188111"
     variation       11041..11049
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttttatatt"
                     /db_xref="dbSNP:934150347"
     variation       11041..11044
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1645959570"
     variation       11046
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645959687"
     variation       11050
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645959736"
     variation       11051
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175609979"
     variation       11052
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425938053"
     variation       11058
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645959918"
     variation       11061
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051230848"
     variation       11062
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645960017"
     variation       11070
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1317511757"
     variation       11076
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:906771930"
     variation       11078
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1040157330"
     variation       11081
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148731364"
     variation       11082
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1437053986"
     variation       11086
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940262733"
     variation       11089
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645960401"
     variation       11090
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1171516285"
     variation       11095
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1231609646"
     variation       11099
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645960576"
     variation       11101
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183246331"
     variation       11103
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148731378"
     variation       11104
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1033807276"
     variation       11106
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645960749"
     variation       11111
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645960818"
     variation       11113
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645960867"
     variation       11115
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645960923"
     variation       11116
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223766443"
     variation       11117
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:959493286"
     variation       11119
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1282794742"
     variation       11122
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331785007"
     variation       11126
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565061414"
     variation       11127..11130
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggtg"
                     /replace="ggtggtg"
                     /db_xref="dbSNP:1433070917"
     variation       11132
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645961260"
     variation       11136
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645961306"
     variation       11142
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148731402"
     variation       11143
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252699110"
     variation       11149
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:989617154"
     variation       11151
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324155466"
     variation       11152..11154
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:35360401"
     variation       11155
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1022309525"
     variation       11156
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247403885"
     variation       11157
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645961677"
     variation       11158
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645961719"
     variation       11159
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1469669349"
     variation       11160
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645961803"
     variation       11162
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:966786785"
     variation       11164
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645961931"
     variation       11166
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645961981"
     variation       11168
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978102549"
     variation       11169
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458699622"
     variation       11171..11183
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctcagttgctctc"
                     /replace="ctcagttgctctcagttgctctc"
                     /db_xref="dbSNP:932315942"
     variation       11173
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772665781"
     variation       11174
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645962253"
     variation       11177
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1438311565"
     variation       11181
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645962360"
     variation       11184
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331275123"
     variation       11186
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645962442"
     variation       11187
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148731442"
     variation       11191
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440877349"
     variation       11194
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645962519"
     variation       11198
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645962556"
     variation       11199..11203
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttctt"
                     /db_xref="dbSNP:1645962608"
     variation       11201
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1645962698"
     variation       11201
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:933913300"
     variation       11206
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1277194365"
     variation       11207..11208
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ta"
                     /replace="tata"
                     /db_xref="dbSNP:1645962827"
     variation       11207
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1352880263"
     variation       11210
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1229529982"
     variation       11211
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645962916"
     variation       11213
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:985818181"
     variation       11216
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780359581"
     variation       11219
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645963039"
     variation       11222
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532437523"
     variation       11223
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1333104450"
     variation       11224
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:941138142"
     variation       11226
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645963237"
     variation       11229
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547982368"
     variation       11232
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645963342"
     variation       11235
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645963392"
     variation       11237
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290902326"
     variation       11238
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373686806"
     variation       11241
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1179771257"
     variation       11243
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645963572"
     variation       11245
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645963634"
     variation       11246
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1254058861"
     variation       11247
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1473570625"
     variation       11248
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645963769"
     variation       11249..11255
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aata"
                     /replace="aataata"
                     /db_xref="dbSNP:1645963806"
     variation       11250
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:929744265"
     variation       11253
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1368577431"
     variation       11257
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645963949"
     variation       11258
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645964002"
     variation       11260
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1342960689"
     variation       11261
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236022849"
     variation       11263
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571391071"
     variation       11265
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645964181"
     variation       11266
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:955855642"
     variation       11267
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645964273"
     variation       11271
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280679964"
     variation       11272
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571391096"
     variation       11274
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1011523316"
     variation       11276
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645964460"
     variation       11279
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645964497"
     variation       11283
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:566097843"
     variation       11287
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351790848"
     variation       11289
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645964638"
     variation       11291
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645964690"
     variation       11293
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645964746"
     variation       11297..11307
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctg"
                     /replace="ctgacttactg"
                     /db_xref="dbSNP:1557632990"
     variation       11302..11304
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tta"
                     /db_xref="dbSNP:1411012960"
     variation       11304
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645964884"
     variation       11307
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645964938"
     variation       11309
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557632999"
     variation       11314
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968116522"
     variation       11316
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1262009984"
     variation       11317
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537000935"
     variation       11326..11328
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1487119334"
     variation       11326
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645965170"
     variation       11330
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:548591833"
     variation       11331
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569703352"
     variation       11332
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645965386"
     variation       11335
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:955413619"
     variation       11339
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645965488"
     variation       11342
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645965534"
     variation       11343
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645965587"
     variation       11344
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001213093"
     variation       11345
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1276915536"
     variation       11346
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:751069758"
     variation       11347
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537024441"
     variation       11348
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1055271617"
     variation       11349
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210193915"
     variation       11350
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645965962"
     variation       11353
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256753454"
     variation       11357
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:895417653"
     variation       11359..11371
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tgcactgagtatt"
                     /replace="tgcactgagtattgcactgagtatt"
                     /db_xref="dbSNP:1195903376"
     variation       11359
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1011008122"
     variation       11363
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:986984923"
     variation       11364..11368
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tgagt"
                     /db_xref="dbSNP:1645966287"
     variation       11367
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645966332"
     variation       11368..11372
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tattt"
                     /db_xref="dbSNP:1645966383"
     variation       11372
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368812370"
     variation       11382..11383
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:768505111"
     variation       11384
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:908733349"
     variation       11394
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1022445034"
     variation       11397
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940169695"
     variation       11398..11399
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1429852086"
     variation       11398
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645966696"
     variation       11403
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645966780"
     variation       11404..11409
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="atcttt"
                     /db_xref="dbSNP:1645966820"
     variation       11406
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645966871"
     variation       11407
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645966935"
     variation       11414
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1038648489"
     variation       11417
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645967015"
     variation       11420..11426
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="act"
                     /replace="acttact"
                     /db_xref="dbSNP:1439339547"
     variation       11421
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:920167348"
     variation       11422
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:558557808"
     variation       11426
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454227670"
     variation       11427
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645967251"
     variation       11428
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1335354894"
     variation       11432
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645967331"
     variation       11433..11436
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="at"
                     /replace="atat"
                     /db_xref="dbSNP:760214668"
     variation       11433
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:577028704"
     variation       11434
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645967498"
     variation       11435
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645967559"
     variation       11439
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292926775"
     variation       11441
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1233660586"
     variation       11443
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645967686"
     variation       11445..11447
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1645967724"
     variation       11446
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747536325"
     variation       11450
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:534379333"
     variation       11463
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1000050388"
     variation       11466
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645967961"
     variation       11468..11475
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttgtt"
                     /replace="ttgttgtt"
                     /db_xref="dbSNP:774358868"
     variation       11483
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645968060"
     variation       11485..11488
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gt"
                     /replace="gtgt"
                     /db_xref="dbSNP:1482267019"
     variation       11486
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906981995"
     variation       11489..11495
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctc"
                     /replace="ctcactc"
                     /db_xref="dbSNP:1645968230"
     variation       11490
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002603071"
     variation       11493..11496
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1392008923"
     variation       11501
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442744285"
     variation       11504
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1029659910"
     variation       11508
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571391359"
     variation       11509..11510
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1449640571"
     variation       11514
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645968581"
     variation       11515
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172540728"
     variation       11519
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645968854"
     variation       11521
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1375424872"
     variation       11522
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645968957"
     variation       11523
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:891663260"
     variation       11526
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645969054"
     variation       11527
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:955516294"
     variation       11528
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:13374690"
     variation       11529
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186500181"
     variation       11530
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761501941"
     variation       11534
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021545390"
     variation       11537
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366214165"
     variation       11540
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645969491"
     variation       11543
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:900384495"
     variation       11545
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301418755"
     variation       11546
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571391431"
     variation       11548
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645969750"
     variation       11549
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645969790"
     variation       11553
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313994790"
     variation       11554
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:962637582"
     variation       11556
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645969978"
     variation       11558
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645970022"
     variation       11560
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973883790"
     variation       11564
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148731634"
     variation       11565
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256538396"
     variation       11566
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1349816459"
     variation       11570
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308492815"
     variation       11575
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249913556"
     variation       11577
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996864302"
     variation       11578
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645970400"
     variation       11580
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645970455"
     variation       11581
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249649614"
     variation       11586
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645970856"
     variation       11591
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542145695"
     variation       11592
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645970961"
     variation       11603
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645971016"
     variation       11604
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645971074"
     variation       11605
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563417423"
     variation       11606
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773087620"
     variation       11610
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645971253"
     variation       11616
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576054752"
     variation       11620
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645971355"
     variation       11621
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645971407"
     variation       11624
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:543429815"
     variation       11625
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215887950"
     variation       11628
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1176111045"
     variation       11629
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1571391522"
     variation       11630..11639
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaaa"
                     /replace="aaaaaaaaa"
                     /replace="aaaaaaaaaa"
                     /replace="aaaaaaaaaaa"
                     /db_xref="dbSNP:148090796"
     variation       11630
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:928413251"
     variation       11639..11640
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:1571391534"
     variation       11639
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191452426"
     variation       11640..11647
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /db_xref="dbSNP:1015679361"
     variation       11640
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:182527149"
     variation       11641
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645972168"
     variation       11642
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1369938681"
     variation       11645
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974606597"
     variation       11646
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1387455843"
     variation       11649
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645972514"
     variation       11651
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645972635"
     variation       11652
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645972708"
     variation       11657
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145217568"
     variation       11658
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:565342652"
     variation       11659
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645973107"
     variation       11663
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980305904"
     variation       11664
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043862956"
     variation       11668
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902717828"
     variation       11669
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1329582447"
     variation       11677
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645973519"
     variation       11679
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:999700616"
     variation       11680
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928334836"
     variation       11681
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419816438"
     variation       11685..11690
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctct"
                     /replace="ctctct"
                     /db_xref="dbSNP:1645974053"
     variation       11686
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1164176522"
     variation       11697
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1415503827"
     variation       11698
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645974332"
     variation       11701
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471932731"
     variation       11703
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:938344896"
     variation       11709
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376645263"
     variation       11710
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188384146"
     variation       11711
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548893620"
     variation       11715
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006870978"
     variation       11716
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299599273"
     variation       11719
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148731724"
     variation       11720
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1297748652"
     variation       11722
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645975152"
     variation       11725
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368752337"
     variation       11726
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:947249893"
     variation       11733
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645975310"
     variation       11734
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645975356"
     variation       11739
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192876785"
     variation       11743..11747
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="cataa"
                     /replace="cataattccataattccataa"
                     /db_xref="dbSNP:1645975465"
     variation       11746..11759
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aagccac"
                     /replace="aagccacaagccac"
                     /db_xref="dbSNP:369200119"
     variation       11746
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1232464621"
     variation       11750
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645975673"
     variation       11752
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996060361"
     variation       11753
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645975778"
     variation       11754
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645975833"
     variation       11755
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:962606885"
     variation       11759..11781
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctg"
                     /replace="ctgggcccagcctcttttacctg"
                     /db_xref="dbSNP:1645975920"
     variation       11760
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645975972"
     variation       11762
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323198939"
     variation       11763
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571391707"
     variation       11767
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1221838658"
     variation       11767
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1030240996"
     variation       11768
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645976236"
     variation       11769
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:891165367"
     variation       11770..11773
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:2148731754"
     variation       11772
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:570383674"
     variation       11774
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645976445"
     variation       11775
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475127738"
     variation       11776
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015678868"
     variation       11778
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571391747"
     variation       11785
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148731770"
     variation       11789
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571391757"
     variation       11790
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437672957"
     variation       11800
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557633486"
     variation       11801
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1424657866"
     variation       11812
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169982834"
     variation       11816
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918514248"
     variation       11818
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1431744049"
     variation       11820
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1308645978"
     variation       11820
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:951256614"
     variation       11821..11822
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="agg"
                     /db_xref="dbSNP:1645977129"
     variation       11821
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:981312528"
     variation       11823
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645977184"
     variation       11825..11828
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1645977241"
     variation       11828
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1300930716"
     variation       11830
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645977370"
     variation       11833
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645977428"
     variation       11837
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1381025451"
     variation       11840
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:928351968"
     variation       11851
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645977573"
     variation       11852
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1228577338"
     variation       11852
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1645977661"
     variation       11853
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753949706"
     variation       11855
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:937117617"
     variation       11856..11859
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1645977831"
     variation       11858
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645977865"
     variation       11862
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1339586279"
     variation       11865..11867
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tat"
                     /db_xref="dbSNP:1645977959"
     variation       11874
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645978012"
     variation       11875..11876
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:1645978071"
     variation       11884
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1229978878"
     variation       11885
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481089017"
     variation       11887
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571391859"
     variation       11888
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485670167"
     variation       11895
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645978364"
     variation       11896..11899
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1208604089"
     variation       11900
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571391875"
     variation       11906
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645978528"
     variation       11908
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239632219"
     variation       11911
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645978639"
     variation       11913
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645978711"
     variation       11919..11922
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1645978750"
     variation       11921
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571391892"
     variation       11925
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645978883"
     variation       11926
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645978962"
     variation       11928
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645979016"
     variation       11931
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645979058"
     variation       11934
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645979099"
     variation       11936
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055378139"
     variation       11940
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187262885"
     variation       11941
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:914270513"
     variation       11942
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946964831"
     variation       11950
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645979475"
     variation       11951..11956
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:1476134044"
     variation       11951
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645979511"
     variation       11960
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645979626"
     variation       11962
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1043914988"
     variation       11963..11964
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ta"
                     /db_xref="dbSNP:1645979734"
     variation       11968
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645979785"
     variation       11970
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571391932"
     variation       11971
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645979859"
     variation       11972
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571391941"
     variation       11975
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645979951"
     variation       11977
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645980009"
     variation       11979
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645980093"
     variation       11982
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902770990"
     variation       11983
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1027592148"
     variation       11985
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645980281"
     variation       11991
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:185134170"
     variation       12003
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1645980422"
     variation       12005
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173836103"
     variation       12009
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360773338"
     variation       12013
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552211427"
     variation       12015
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570414684"
     variation       12017
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645980706"
     variation       12019
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190068140"
     variation       12026
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1172290343"
     variation       12027
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757576530"
     variation       12028
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645981388"
     variation       12032
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:938353158"
     variation       12038
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1007008303"
     variation       12043
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018285710"
     variation       12044
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149163525"
     variation       12045
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645981704"
     variation       12047
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:912995495"
     variation       12048
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1310507008"
     variation       12052
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1356863618"
     variation       12056
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645981907"
     variation       12061
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1313235178"
     variation       12066
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645982028"
     variation       12080
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:898460552"
     variation       12086..12095
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tttctt"
                     /replace="tttctttctt"
                     /db_xref="dbSNP:1246563466"
     variation       12089
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:193204277"
     variation       12097
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1042793716"
     variation       12099..12125
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agaacaaccagtgtcaccaggtatgag"
                     /replace="agaacaaccagtgtcaccaggtatgagaacaaccagtgtcaccaggta
                     tgag"
                     /db_xref="dbSNP:1339311810"
     variation       12103
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477092800"
     variation       12105..12118
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="accag"
                     /replace="accagtgtcaccag"
                     /db_xref="dbSNP:1213116304"
     variation       12107
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427185544"
     variation       12109
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771887940"
     variation       12114
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1308271391"
     variation       12115
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571392090"
     variation       12118
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210499147"
     variation       12119
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900361502"
     variation       12121
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148731916"
     variation       12123
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645982854"
     variation       12126
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645982902"
     variation       12129..12132
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:1645982951"
     variation       12130
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645983009"
     variation       12132
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386145677"
     variation       12138
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1255478039"
     variation       12145
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645983185"
     variation       12147
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1320837542"
     variation       12153
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1330109319"
     variation       12165
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433685241"
     variation       12167
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486733663"
     variation       12168
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368992746"
     variation       12169..12179
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="atttatt"
                     /replace="atttatttatt"
                     /db_xref="dbSNP:1557633790"
     variation       12173
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645983564"
     variation       12180
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1228316139"
     variation       12181
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1267078324"
     variation       12182
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867210431"
     variation       12183
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535270883"
     variation       12189
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148731956"
     variation       12191..12192
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:2148731957"
     variation       12193
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:556704991"
     variation       12196
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266666866"
     variation       12197
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995516199"
     variation       12198
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143723018"
     variation       12207
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1027816144"
     variation       12208
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645984324"
     variation       12209
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184939951"
     variation       12215
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:564988943"
     variation       12221
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645984513"
     variation       12222
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1037409376"
     variation       12223
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:897137584"
     variation       12225
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645984671"
     variation       12226
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1478352732"
     variation       12229..12230
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:1645984799"
     variation       12231
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1433687798"
     variation       12232
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645984944"
     variation       12236
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:958443914"
     variation       12237
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645985054"
     variation       12238
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:991235686"
     variation       12239
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1409603894"
     variation       12239
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1473468758"
     variation       12247
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159541645"
     variation       12248
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:996026993"
     variation       12252
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:548438182"
     variation       12254
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645985441"
     variation       12259
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:947018571"
     variation       12260
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434722116"
     variation       12261
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571392261"
     variation       12266
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1645985663"
     variation       12267
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349919648"
     variation       12269..12276
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="taa"
                     /replace="taagataa"
                     /db_xref="dbSNP:755974130"
     variation       12272
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977126034"
     variation       12275..12284
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aat"
                     /replace="aatacccaat"
                     /db_xref="dbSNP:1645985908"
     variation       12275
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645985847"
     variation       12279
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645985973"
     variation       12283
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1001619664"
     variation       12287
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:550918434"
     variation       12288
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645986209"
     variation       12290
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645986255"
     variation       12297
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1229399720"
     variation       12300
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1283911043"
     variation       12304
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11263839"
     variation       12308
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051688201"
     variation       12311
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:891328088"
     variation       12314
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645986782"
     variation       12317
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780701723"
     variation       12318
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645986930"
     variation       12320..12322
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1645987003"
     variation       12321
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146481099"
     variation       12332
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249536680"
     variation       12333
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1278385240"
     variation       12334
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645987953"
     variation       12336
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350343925"
     variation       12339
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645988075"
     variation       12340
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:968398401"
     variation       12346
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:559571643"
     variation       12350
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645988275"
     variation       12352
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995485036"
     variation       12356
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1414006163"
     variation       12357
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645988661"
     variation       12364
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645988724"
     variation       12365
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445175870"
     variation       12367
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1305566237"
     variation       12373
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1372959969"
     variation       12374
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217920228"
     variation       12375
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333997978"
     variation       12377
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645989073"
     variation       12383
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025669719"
     variation       12388
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645989207"
     variation       12392
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645989264"
     variation       12405..12409
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tcttt"
                     /db_xref="dbSNP:1645989313"
     variation       12407..12409
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1242470958"
     variation       12407
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247378787"
     variation       12413
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453640010"
     variation       12414
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645989501"
     variation       12418
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571392461"
     variation       12419..12424
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ctt"
                     /replace="cttctt"
                     /db_xref="dbSNP:1645989615"
     variation       12420
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645989673"
     variation       12426
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921698461"
     variation       12434
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1191519402"
     variation       12437
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:887014334"
     variation       12438
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645989900"
     variation       12439
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645989950"
     variation       12441
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533887056"
     variation       12442
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530183670"
     variation       12446
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276852075"
     variation       12451
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344318585"
     variation       12455
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645990366"
     variation       12460
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002828799"
     variation       12461
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645990508"
     variation       12462
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1035927223"
     variation       12464..12466
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1396447344"
     variation       12464
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958491341"
     variation       12468
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1440503374"
     variation       12469
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454463169"
     variation       12470
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645990826"
     variation       12473
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645990904"
     variation       12476
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1157441159"
     variation       12481
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645991020"
     variation       12486
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243379749"
     variation       12489
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645991123"
     variation       12501
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051559876"
     variation       12505
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166236015"
     variation       12506
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1391478845"
     variation       12508
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645991327"
     variation       12517
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769437079"
     variation       12522
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1382205794"
     variation       12525
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021299293"
     variation       12529
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1320931704"
     variation       12533
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400641517"
     variation       12534
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645991632"
     variation       12537
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1390026558"
     variation       12539
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940563221"
     variation       12541
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772679199"
     variation       12543
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645991938"
     variation       12554
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645991998"
     variation       12555
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645992071"
     variation       12559
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301734060"
     variation       12561
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542071503"
     variation       12563
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140969609"
     variation       12569
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645992325"
     variation       12574
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645992383"
     variation       12577
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645992429"
     variation       12578
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645992477"
     variation       12579
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:924330559"
     variation       12580
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255367362"
     variation       12582
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1342701448"
     variation       12583
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935573817"
     variation       12585
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148732198"
     variation       12587
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279007528"
     variation       12591
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987031222"
     variation       12592
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1263511842"
     variation       12598
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645992926"
     variation       12601
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:61588338"
     variation       12604
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645993120"
     variation       12606
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645993181"
     variation       12607
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762650705"
     variation       12608
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151209493"
     variation       12610
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3185860"
     variation       12611
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645993405"
     variation       12612
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:617254"
     variation       12616..12623
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tctattct"
                     /replace="tctattctattct"
                     /db_xref="dbSNP:1645993556"
     variation       12619
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:546851825"
     variation       12623
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1047496021"
     variation       12625
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645993755"
     variation       12632
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:887152481"
     variation       12635
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645993882"
     variation       12637
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528057622"
     variation       12640
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1254691093"
     variation       12645
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645994114"
     variation       12649
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645994175"
     variation       12653
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322836145"
     variation       12661
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468625617"
     variation       12662
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546700653"
     variation       12664
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645994690"
     variation       12666
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645994738"
     variation       12673
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1035797650"
     variation       12674
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2148732262"
     variation       12677..12680
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1329329536"
     variation       12680
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1057016314"
     variation       12681
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774166730"
     variation       12685
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894411906"
     variation       12690
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328197100"
     variation       12694
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:617673"
     variation       12702
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645995262"
     variation       12704
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767517357"
     variation       12707
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645995367"
     variation       12711
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645995429"
     variation       12713..12714
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1571392793"
     variation       12713
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1269631761"
     variation       12715
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021438273"
     variation       12717
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470842580"
     variation       12722
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:968427356"
     variation       12723..12724
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:1645995834"
     variation       12723
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1158659180"
     variation       12724
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538220647"
     variation       12725
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645995946"
     variation       12733
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2148732301"
     variation       12739
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:998649331"
     variation       12740
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1208787348"
     variation       12741
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1645996125"
     variation       12746
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148732312"
     variation       12758
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1264651380"
     variation       12758
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1645996176"
     variation       12759
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645996290"
     variation       12762
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645996337"
     variation       12763..12767
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ga"
                     /replace="gagga"
                     /db_xref="dbSNP:2148732324"
     variation       12763
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1435467966"
     variation       12765
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031750925"
     regulatory      12767..12772
                     /regulatory_class="polyA_signal_sequence"
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="hexamer: ATTAAA"
     variation       12770
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1461411805"
     variation       12779
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645996576"
     variation       12782
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411815515"
     variation       12786
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1471831102"
     variation       12787
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161741391"
     variation       12788
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1010933207"
     polyA_site      12790
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="major polyA site"
     variation       12790
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954369519"
     variation       12791
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535494736"
     variation       12793
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645996920"
     variation       12794
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1397201950"
     variation       12802
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645997025"
     variation       12807
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291927465"
     variation       12808
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645997119"
     variation       12810
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556743507"
     variation       12813
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:912794404"
     variation       12818
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:568710793"
     variation       12819
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328509541"
     variation       12829..12830
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1645997459"
     variation       12830
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1349724926"
     variation       12831
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645997560"
     variation       12832
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645997604"
     variation       12837
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645997657"
     variation       12838
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:964311587"
     variation       12841
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645997748"
     variation       12846
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:975565048"
     variation       12851
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645997839"
     variation       12852..12856
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggggg"
                     /replace="gggggg"
                     /db_xref="dbSNP:1289970722"
     variation       12852
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920123616"
     variation       12853
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931383205"
     variation       12854
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645998053"
     variation       12856
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1317214475"
     variation       12857
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645998148"
     variation       12858
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921685638"
     variation       12861
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263224418"
     variation       12862
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645998386"
     variation       12864
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645998430"
     variation       12868..12878
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aagaagaa"
                     /replace="aagaagaagaa"
                     /db_xref="dbSNP:1489191079"
     variation       12871
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047104846"
     variation       12878..12884
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aag"
                     /replace="aagtaag"
                     /db_xref="dbSNP:953077202"
     variation       12878
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1482325926"
     variation       12881
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:987319587"
     variation       12882
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1645998748"
     variation       12897
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908631026"
     variation       12906
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1423500069"
     variation       12911
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1645998885"
     variation       12915
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645998944"
     variation       12917
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1334020336"
     variation       12918
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148732424"
     variation       12923..12928
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttgttt"
                     /db_xref="dbSNP:1425388438"
     variation       12923..12927
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="ttgtt"
                     /db_xref="dbSNP:551871231"
     variation       12926..12928
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1571393013"
     variation       12927
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1645999245"
     variation       12930
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1307434820"
     variation       12934
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754003469"
     variation       12937
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911758811"
     variation       12938
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763435450"
     variation       12942
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373764064"
     variation       12947
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:894380672"
     variation       12949
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:11803162"
     variation       12950
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323075098"
     variation       12954
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571393070"
     variation       12956
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1645999839"
     variation       12960
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1195017326"
     variation       12968
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:557614640"
     variation       12972
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1340744989"
     variation       12974
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1207879034"
     variation       12975
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1233865788"
     variation       12978
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646000122"
     variation       12980
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646000167"
     variation       12983
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646000219"
     variation       12986
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483140763"
     variation       12987
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188246113"
     variation       12991
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180440137"
     variation       12996
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646000397"
     variation       12997
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1258548504"
     variation       13000
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1646000491"
     variation       13010
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646000550"
     variation       13017
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1445453595"
     variation       13020
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388370039"
     variation       13028
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1427799237"
     variation       13030
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646001427"
     variation       13031..13032
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1646001486"
     variation       13033
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172476848"
     variation       13040
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646001597"
     variation       13041..13045
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:1465366528"
     variation       13041
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1300800227"
     variation       13042
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646001729"
     variation       13044
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384613036"
     variation       13048
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765512570"
     variation       13052
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1296280568"
     variation       13053
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1646001941"
     variation       13064
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:999103079"
     variation       13067
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1031390116"
     variation       13069
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1274361357"
     variation       13072
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1312064304"
     variation       13080
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1048361259"
     variation       13086
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954633333"
     variation       13097
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008543100"
     variation       13102
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1646002395"
     variation       13102
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646002331"
     variation       13105
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258131628"
     variation       13111
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2148732519"
     variation       13114
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646002496"
     variation       13115
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1646002562"
     variation       13116
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646002643"
     variation       13117
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1461969099"
     variation       13121
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1646002723"
     variation       13131
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646002777"
     variation       13132
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750676879"
     variation       13136
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372215826"
     variation       13141..13146
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agatag"
                     /replace="agatagatag"
                     /db_xref="dbSNP:747128678"
     variation       13141
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246372871"
     variation       13142
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646003040"
     variation       13144
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:541089374"
     variation       13146
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420464265"
     variation       13152..13154
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:1458669625"
     variation       13156
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420152307"
     variation       13158
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975699442"
     variation       13161..13164
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1646003844"
     variation       13165
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920175823"
     variation       13168
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1407985565"
     variation       13172..13177
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:879476871"
     variation       13173
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553296373"
     variation       13175
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:983370268"
     variation       13179
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1166121037"
     variation       13183
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1000280959"
     variation       13185
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646004353"
     variation       13187..13188
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1028638611"
     variation       13188
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571393323"
     variation       13189..13196
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaa"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /replace="aaaaaaaaa"
                     /db_xref="dbSNP:537923747"
     variation       13189
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:908602603"
     variation       13190
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181064431"
     variation       13193
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:542295369"
     variation       13196
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:563919064"
     variation       13197
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:112898338"
     variation       13198
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480657929"
     variation       13199
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646005279"
     variation       13200
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249438005"
     variation       13213
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341003490"
     variation       13215
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646005638"
     variation       13218
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948637090"
     variation       13219
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409385468"
     variation       13224
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042915926"
     variation       13225
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318454112"
     variation       13229
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1348773393"
     variation       13233..13240
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="atga"
                     /replace="atgaatga"
                     /replace="atgaatgaatga"
                     /db_xref="dbSNP:927327408"
     variation       13237
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346625871"
     variation       13241
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937333611"
     variation       13244
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546552052"
     variation       13250
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646006216"
     variation       13253..13261
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aata"
                     /replace="aataaaata"
                     /db_xref="dbSNP:1646006249"
     regulatory      13253..13258
                     /regulatory_class="polyA_signal_sequence"
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="hexamer: AATAAA"
     variation       13256..13259
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1057183876"
     variation       13256
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646006294"
     variation       13257
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1353187187"
     variation       13260
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:895865063"
     variation       13262
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278971952"
     variation       13270
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113322531"
     polyA_site      13275
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
     variation       13276
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751968895"
     variation       13281
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1041857755"
     variation       13282..13284
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1490476437"
     variation       13283
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260154197"
     variation       13284
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646006975"
     variation       13285..13292
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tatt"
                     /replace="tatttatt"
                     /db_xref="dbSNP:1181268134"
     variation       13285
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409449668"
     variation       13287
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556209808"
     variation       13288
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646007200"
     variation       13291..13292
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1158810267"
     variation       13294
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1412573968"
     variation       13296
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646007375"
     variation       13302
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890196881"
     variation       13306
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1164876514"
     variation       13309
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1366804179"
     variation       13314
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1000473891"
     variation       13315
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646007686"
     variation       13316
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646007746"
     variation       13318
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:528752687"
     variation       13323
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371743303"
     variation       13324
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148732668"
     variation       13328..13333
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ggggg"
                     /replace="gggggg"
                     /db_xref="dbSNP:1646007997"
     variation       13328
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1337878891"
     variation       13329
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646008067"
     variation       13333
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017276949"
     variation       13336
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646008138"
     variation       13340..13346
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agta"
                     /replace="agtagta"
                     /db_xref="dbSNP:1571393515"
     variation       13341
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1646008232"
     variation       13343
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646008319"
     variation       13345..13355
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="taaataa"
                     /replace="taaataaataa"
                     /db_xref="dbSNP:1463701048"
     variation       13348
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283853555"
     variation       13356
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1354426697"
     variation       13358
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646008521"
     variation       13359
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646008564"
     variation       13363
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646008605"
     variation       13369
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646008643"
     variation       13370
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1029234276"
     variation       13371
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646008780"
     variation       13381
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360124812"
     variation       13383
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204324335"
     variation       13388
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755507279"
     variation       13391
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:994515114"
     variation       13391
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1248268375"
     variation       13397
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1646009159"
     variation       13400
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646009214"
     variation       13402
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439377406"
     variation       13407
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646009303"
     variation       13413
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1027212716"
     variation       13414
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150294351"
     variation       13415
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1646009423"
     variation       13417
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148732720"
     variation       13419
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1375077345"
     variation       13423
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646009514"
     variation       13431
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471600869"
     variation       13435
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571393572"
     variation       13436
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184975862"
     variation       13437
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137937874"
     variation       13439
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646009749"
     variation       13441
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018716062"
     variation       13445
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747667827"
     variation       13446
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557634949"
     variation       13447
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:972327090"
     variation       13448
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755634987"
     variation       13449..13451
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="ttt"
                     /db_xref="dbSNP:1333857852"
     variation       13451
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:992913212"
     variation       13452
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1027513323"
     variation       13454
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866611493"
     variation       13455
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:915999164"
     variation       13456
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1571393625"
     variation       13457
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1315881943"
     variation       13458
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948694188"
     variation       13459
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:951959518"
     variation       13460
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1646010429"
     variation       13461
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369177016"
     variation       13462
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1249546128"
     variation       13463..13470
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /replace="aaaaaaaaa"
                     /db_xref="dbSNP:926539078"
     variation       13467
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1646010659"
     variation       13471
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646010719"
     variation       13472
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978750367"
     variation       13473
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1277644378"
     variation       13475
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646010976"
     variation       13476..13484
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gg"
                     /replace="ggggtaggg"
                     /db_xref="dbSNP:1459736713"
     variation       13476
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757440604"
     variation       13477
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646011106"
     variation       13478
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646011168"
     variation       13481
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:937345012"
     variation       13486
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646011287"
     variation       13489
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646011345"
     variation       13490
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2148732793"
     variation       13491..13509
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gggagggtggagaagagag"
                     /replace="gggagggtggagaagagagggagggtggagaagagag"
                     /db_xref="dbSNP:1646011402"
     variation       13495
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646011442"
     variation       13497
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:992754289"
     variation       13498
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1557635040"
     variation       13502
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777335358"
     variation       13503
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646011644"
     variation       13504..13513
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="agagagag"
                     /replace="agagagagag"
                     /replace="agagagagagag"
                     /db_xref="dbSNP:917332610"
     variation       13504
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400487753"
     variation       13505
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052949107"
     variation       13507
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337672685"
     variation       13508
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1042173951"
     variation       13510
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433002965"
     variation       13511
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890323189"
     variation       13514
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:944523722"
     variation       13517
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646012268"
     variation       13518
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926170271"
     variation       13521
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646012396"
     variation       13523
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328194233"
     variation       13527
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228031040"
     variation       13528
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1274083950"
     variation       13529
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1038766385"
     variation       13530
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:936153832"
     variation       13533
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646012670"
     variation       13534..13537
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1646012732"
     variation       13538
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646012802"
     variation       13539
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646012848"
     variation       13543
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646012914"
     variation       13544
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:900268718"
     variation       13546..13550
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="gctcc"
                     /db_xref="dbSNP:1646013091"
     variation       13546
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1263381056"
     variation       13550
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646013169"
     variation       13552
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:994483877"
     variation       13553
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1027759385"
     variation       13555
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1260081808"
     variation       13558..13563
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:1430597782"
     variation       13564
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189626933"
     variation       13567
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748935515"
     variation       13568
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646013928"
     variation       13572..13573
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:1646013985"
     variation       13573
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1646014059"
     variation       13575
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646014128"
     variation       13576
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571393759"
     variation       13577
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:888693143"
     variation       13578
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1571393772"
     variation       13579
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529029363"
     variation       13582
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550254208"
     variation       13584
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448127823"
     variation       13588
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198804497"
     variation       13594
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452846937"
     variation       13597
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646014790"
     variation       13598
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:568745685"
     variation       13599
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:539225869"
     variation       13600
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481624921"
     variation       13601
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646014975"
     variation       13602
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646015038"
     variation       13606
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1646015106"
     variation       13608
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1177526516"
     variation       13613
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:557502575"
     variation       13614
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008583388"
     variation       13617
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770599707"
     variation       13618
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:566671117"
     variation       13621
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1571393823"
     variation       13624
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1290747057"
     variation       13625
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385739329"
     variation       13627
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:992965566"
     variation       13628
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149480174"
     variation       13631
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1359870567"
     variation       13633
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1571393854"
     variation       13634
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452955599"
     variation       13635
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372205273"
     variation       13636
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1646016011"
     variation       13637
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1283671820"
     variation       13647
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387050257"
     variation       13648..13650
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1328134606"
     variation       13649
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236404859"
     variation       13651
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1435466336"
     variation       13653
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:978718021"
     variation       13654
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:993290863"
     variation       13656
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646016404"
     variation       13657
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:925979776"
     variation       13658
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:951950535"
     variation       13661
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148732980"
     variation       13664..13666
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1646016530"
     variation       13667
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2148732983"
     variation       13671
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:955978316"
     variation       13673
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646016728"
     variation       13674..13678
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="gtg"
                     /replace="gtgtg"
                     /db_xref="dbSNP:1490979203"
     variation       13675
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1200680347"
     variation       13678
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646016843"
     variation       13680
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1251501560"
     variation       13681
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:989092655"
     variation       13684
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145835702"
     variation       13685
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138746703"
     regulatory      13689..13694
                     /regulatory_class="polyA_signal_sequence"
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /note="hexamer: ATTAAA"
     variation       13689
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:960582832"
     variation       13692..13694
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="aaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:530985639"
     variation       13695
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646017641"
     variation       13698..13701
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:150609292"
     variation       13703
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2148733025"
     variation       13705
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1557635273"
     variation       13705
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967767747"
     variation       13706
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1646017835"
     variation       13708
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303579430"
     polyA_site      13712
                     /gene="AGO1"
                     /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
ORIGIN      
actggcagctggccgggcgctcgcagtgggagctgctgcaggctccgcggcggcggcaacggaggctgcgggggcggcggcgcgagcggccgggcttggtaggggagccgagcccggcccgggatcccgagcagcgagagtgtggggtacctaggcccctcacgctggacttcacagtctccgggccgcctgacctccgcacgggtatatgggatggaagcgggaccctcgggagcagctgcgggcgcttacctgccccccctgcagcaggtgttccaggcacctcgccggcctggcattggcactgtggggaaaccaatcaagctcctggccaattactttgaggtggacatccctaagatcgacgtgtaccactacgaggtggacatcaagccggataagtgtccccgtagagtcaaccgggaagtggtggaatacatggtccagcatttcaagcctcagatctttggtgatcgcaagcctgtgtatgatggaaagaagaacatttacactgtcacagcactgcccattggcaacgaacgggtcgactttgaggtgacaatccctggggaagggaaggatcgaatctttaaggtctccatcaagtggctagccattgtgagctggcgaatgctgcatgaggccctggtcagcggccagatccctgttcccttggagtctgtgcaagccctggatgtggccatgaggcacctggcatccatgaggtacacccctgtgggccgctccttcttctcaccgcctgagggctactaccacccgctggggggtgggcgcgaggtctggttcggctttcaccagtctgtgcgccctgccatgtggaagatgatgctcaacattgatgtctcagccactgccttttataaggcacagccagtgattgagttcatgtgtgaggtgctggacatcaggaacatagatgagcagcccaagcccctcacggactctcagcgcgttcgcttcaccaaggagatcaagggcctgaaggtggaagtcacccactgtggacagatgaagaggaagtaccgcgtgtgtaatgttacccgtcgccctgctagccatcagacattccccttacagctggagagtggacagactgtggagtgcacagtggcacagtatttcaagcagaaatataaccttcagctcaagtatccccatctgccctgcctacaagttggccaggaacaaaagcatacctaccttcccctagaggtctgtaacattgtggctgggcagcgctgtattaaaaagctgaccgacaaccagacctcgaccatgataaaggccacagctagatccgctccagacagacaggaggagatcagtcgcctgatgaagaatgccagctacaacttagatccctacatccaggaatttgggatcaaagtgaaggatgacatgacggaggtgacagggcgagtgctgccggcgcccatcttgcagtacggcggccggaaccgggccattgccacacccaatcagggtgtctgggacatgcgggggaaacagttctacaatgggattgagatcaaagtctgggccatcgcctgcttcgcaccccaaaaacagtgtcgagaagaggtgctcaagaacttcacagaccagctgcggaagatttccaaggatgcggggatgcctatccagggtcaaccttgtttctgcaaatatgcacagggggcagacagcgtggagcctatgttccggcatctcaagaacacctactcagggctgcagctcattattgtcatcctgccagggaagacgccggtgtatgctgaggtgaaacgtgtcggagatacactcttgggaatggctacgcagtgtgtgcaggtgaagaacgtggtcaagacctcacctcagactctgtccaacctctgcctcaagatcaatgtcaaacttggtggcattaacaacatcctagtcccacaccagcgctctgccgtttttcaacagccagtgatattcctgggagcagatgttacacaccccccagcaggggatgggaaaaaaccttctatcacagcagtggtaggcagtatggatgcccaccccagccgatactgtgctactgtgcgggtacagcgaccacggcaagagatcattgaagacttgtcctacatggtgcgtgagctcctcatccaattctacaagtccacccgtttcaagcctacccgcatcatcttctaccgagatggggtgcctgaaggccagctaccccagatactccactatgagctactggccattcgtgatgcctgcatcaaactggaaaaggactaccagcctgggatcacttatattgtggtgcagaaacgccatcacacccgccttttctgtgctgacaagaatgagcgaattgggaagagtggtaacatcccagctgggaccacagtggacaccaacatcacccacccatttgagtttgacttctatctgtgcagccacgcaggcatccagggcaccagccgaccatcccattactatgttctttgggatgacaaccgtttcacagcagatgagctccagatcctgacgtaccagctgtgccacacttacgtacgatgcacacgctctgtctctatcccagcacctgcctactatgcccgcctggtggctttccgggcacgataccacctggtggacaaggagcatgacagtggagaggggagccacatatcggggcagagcaatgggcgggacccccaggccctggccaaagccgtgcaggttcaccaggatactctgcgcaccatgtacttcgcttgaaggcagaacgctgttacctcactggatagaagaaagctttccaagccccaggagctgtgccacccaaatccagaggaagcaaggaggagggaggtggggtagggaggagtgtaggatgccttgtttccttctatagaggtggtgtaagagtggggaacagggccagcaagacagaccaccagccagaaatctctgatatcaacctcatgtcccccacccctcaccccatcttgtcacatctggccctgaccccactggaccaaaaggggcagcactggtgcccaccatacacacaggtgtctcatgtgactcacagtgctaaagactcatgcttgacagcttggtaaggtcaactctgtagccctgcagacaaaagctggttaggtttgggtttgatactttagatgggaaagtgaggggcttgagaaagtgggtgggaggagggaaggattttttaggagccttaatcagaaaaggactagatttgtttaagaagaaaaatgaaaccagacccagatcaatattttaggatactagatgttttaatgggttcagaatccagtttgtaggaagattttttaatggttttggttgctcctcccccagctgccaccccccaccttacccttattcctctctgtccacattttctgccccaccttacttctcctccctgacagacatccagcccctagtaatacttaaggcactatggcacttagctttgaagtgacacgaccctgtcttccttccgcccgctggtgggtaaccagtgccttccctgtaacggtaatgctgcagaactgcaaccttttgtacctttctttggggaatggggtgggggtgggagaggaggtagatggggaagaaataccccagacccaacaaacctccagccagaaagccagctattttgcatttgaaggaattgacttcctcattcattgagctttttaaaagatcacaacctcaagatggttaaaatccattgacatttgcactttcaaacatgacaagtctcggagctgctgagatgacaggcccctggcctttccacttatgcctccttttctccttattcctcctacctcccgccccgcccaggtctggagttactttcatagcatttttcactcttggcttcttttctcccttgatggtcaagtctcttatgtttcaatatttcttaactggggtgtcttataacaaaaaactcttaggtctaaaatgagaaaaaagagagaaaacaaaatgttatttttataccataacttgagtgtattgccaaaatttggaaatccttcccatgcctgatgagtttatatcccagaaacattgagccatcagaatgaactgtgtacctgatttgttctctgacctggctaggtagggagggggtggttatcgccccaagatggggtccaggctccatccttcctctgtgcagataatacctttttcttgctatagcctccctcctctgcactgtcctgcactctttcttgcaagtgcatctttttccttcccctggactgtcctctgaccctttggctcatcctagattgcagtgtgtcctgtggacaggctggggaattttgctgctccctattgcttctgtttacaaaaatgaatttttcctggtttcccactagggcatgtgggtgggtggcatggacttttttttttttttttttttgtcttgagacatggggtttggctgtcttgcaggactggagaaggtggtggttctagcttggtctctgttggccttgaagcaagcatcccccctgccctttttccttgactgttcatttttttcctgccccactgcttgggatggggagttgcaacttcagtgtggaatttcctctttgaggagcctgggcttggatctatcctgatctggtgatgaagccatgattactttagacctagcccaggcttggaggccagctggaggaagaagggtctaaatcctggcctgtagagttagaactaccatttcctccccttagctgcccttgtatgacccggatttgctatgcaaaacaatctatcccaggttctgttctggttggctacattgttcagcaactcacaaaacgtagcacaaacattcattatggagaaagcatcaggactgttgagtaactcctcctttacttttttcctgctggctacagcatggggtgccctataggcacaagcccagctgaagaacagaatggagggctctgggaggaggcagctcactggagagcctacattccttacacaagtgcctaaagagagtgatgctaacactccatctgccctgtccattgccttcatatacagtctacttcgtgttctgtcaccctttggggaggggagttctcctgggacagtgggctctgcatgttctccacttggatacattttggggctaggatcagggcactattcctggagggtccagtcattcaccagcatttgcaaatgtccatagggagcaggtggcagcctctactcccagcaacaagtttgtgttctctccttttctctctttgcctcactctctccagttggttttcagctggggcttgaaatgcatttttagccctttgacgtggcttatgccattcaagaaataaaaagcaagagaatcagctttgggcaatgacaagaaatgagttcttactctgatttttttgtaaaaagataatttttgagacttgaaaaataccccgaccttgagattattcctgtttgaaaggtggtgcatgcagatggagaagtggtgttggcagcaagctttggctcatgtggatttggtttaagtggtgcttcttacccaagcttcaaggaagtgcttgggggacccccagcctcatcctcttagttgggtctcttgttccctttgtaccactgttttgccttccttttcctcttctctctttgcctggcttcctttcccttttcttctattcactctgcttgcttgctggccggcctgcctgcctgcctgcctgcctgcctgcctgtctgcctatgtgatgatgaaatctctgcatggctgcaatgatcccactgttagctggcagggtcaggcttagctccttgactgcagaagaccaagaacctgttccccaagcccagagatgtccacctgggctggactgccctcaagcttatactagagaagagcaactgacctgcccaacttgtgtgaagtcaggagggtttctggcattttccacacctgtccactccttggagctggtttctctcattgctttttctaaatctggttctttttctctttacctggggcctggcttttctgagattgtcttagggttgagctatttgggtatcctgggtttgagtgttaggggatggacataaaggaaaaagagtgatgagaagagaatggagagaatttgaataaaaggtgggaaaggagagcactgttctttgattgtttatccagtccaacctgatccattagggatcgaggtgctacactggcctccagggataagcctggggctactgttgctgggaacttaggcttaacataaagccgaagaaggtacctagaaatttgaaacttccctaaaaagctcctaatgcccacctgctagatagcttctctgtggcctcctatttagctaagcagcagtgtttttggatactttttttttctgtttgtgaataaggccagcactcaagatgggcagccaagggtgcactgactattagctggcccataggatatctgtaaggctggtgggacagttttggacctggaatcatgtgtaactaacaaggttggacgtttcttccccatcagggtagaaaaatcatctcaaactagccaaaaggcagttttggaaactacattgggggacgttatttttatttatatatggggcctaggccaatccaggatggtagctggaataccttccttcttaaaatctgatcatggcagggatatgcagggcactttttactatttggccttctaagcagattgggaaggaggtattttctggttttcgctttcctccgacttaataggacttgccttctccctgggcagggagagaggctgggttggtgctctcccttactctactcatactgacttagagcctctggctgctgtttgggcatccaagaaagggaggggaaggaatgagctaaaaacaaaacagaatgaggtgggaaagggagattttcttctttacagaggaaaataggaaaccctccaagaattgtgcaagtaaagacatttgttgaatgcactgagtcccttggtgtagtagcaataaggaaaaatgaaattactttcctgtgcacacagtccagcctaattggtatgtgatgttgcacttagcagccatgtggtgggcatgtgtgactactctggttttcactttagtttctaaactttttatccctctcaagtccagcatggatggggaaatgtctctggatccccacagctgtgtacttgtttgcatttgtttccctttgagatttgtgtttgtgtcctgctttgagctgtaccttgtccagtccattgtgaaattatcccagcagctgtaatgtacagttccttctgaagcaagcaacatcagcagcagcagcagcagcagcacaattctgtgttttataaagacaacagtggcttctatttctaaagtgcggtctttctctttttttttcctaccagcaaaacaaacttttgggactgattacatctctaatagattttaggtgagaataatactgtagattgttatgcaggaatacttcacagagccttcatttattcttcattcaacaaacatgcaaagcactgtgccagcagtattgtggggaggggaggcacaattcaaaatgaggaaaatagtgtccgtctcattaagggaattaagtttggtgggggatatgattagccaaatagtcccctggcataggaggaagataatgagggagtggaataaggctacaacaacgaatatagggaggaagggacagatttgagagacgaggtagaattaataggactcgatggctggtgggaggagaagacaggagtagaggttagctcccaggtttctccttgaccataggagtgtgttgggacattctgccagtcaagatgggggtgacggggagactgtagaaggaaggtggggagtttttgaagaaacagaatgttgtatagactgagttttgaggtgtttgtggggcagtaagggtaaggtgtccagtaaacacaggttggtgctcaggtaagactgtaaaactgcatttatagatacaggagtcttatagatggtagttaaagccataggcatgaatgagatagcttagaaaaagagaagagaaactagtatacagccccctaagaaactcaatttaaaggttcgggggaggaagcagatcttaaggtgacagatcactggtagacagtttgtgggttttttgtttctttgtttagccagtttggtgaggtaggagaagaaatcagagtagaagaaggttcatgaagggagtgattaacaacatgaactgctgcagagagggagttctttttttttctgtgtgttttacctttctactccccatcttttggggatcttgtaactctatgacttacttacgttattctccagtatttcttgaaaatgagcattggaaaaaccaattctaaaatggctaaaactaggactttcaagttcaccacaactaccaccaattaggagataattgtaaaagaataaacaaaacctaattttgttcctagccaatattataaaccatgttccagcatactagataatagtagcatactatatttatttccataatttgtcttctttagagcctatgaactcctaggagcagaagctatattctcttcatttttgtcatctcagggtcatggcatataccaacagatcagtatgtgcaaatataattgaaataggctagtagtctgtggtttatgagtatgggctgggtgggcagtggatcaagaagtgataggagtacacaggatgaactcagaattcctgaatcttcaggtaagcagatacttaactacattatcattgtcttttcccactcaccccaagttggaggttctatggttttgtactttaagctggtggtataattgtcaagcatgtaaattctggcattcttcctggtactgctagagcattgttatttctatgcatgggggtaagaaggctcagagaaggatcctggcggataccccagtgagaaatcgtcagtggcagccagtgtgtacatacgtggacctagcattcctctggaggccaagtgttgtaaattggcctgtggctatcatctggcagactcccttgggaaagagccagccagccccatgcttcttttcagcagcaagggttagggaggttggttgaacttgaagagcagattggacatggagcagattttgaccagttgaaataagacataaatttatgactccgagtgaggcagaaataaagaacttagcagggggaataggaggaggatgattatggcaaattttgctataaactttagttttagaaaagattgatattgaaaagccttcaggatttgcctgtggttgctactcaagttaaaaagactgggagcctgcattgtttggtcctggagctcaaggttttcagtgaaggcttgtcctggcacctctgggcattccttttcattactggttgagcatccttccttctgctctgtcaattggcaaaatatgctggagcacattctggactagcagttgccttggggtagtcaggctgggtatttgtttggtatctcttggtgtagcagaccccagaatctcatggcaattaggatttggtggctaaacgaaagagttagtgcaaggaaaagcctagttggaatttctgagtctgggccatccttaagctgctgtctactgcctgaatgggaagtaatgtcgaattggaaaattagctcaccatttttgttctagctttgcagacatttattcctctgatgataggctgagaaatgcctaggccggcttagaaggcacacagcatgacagaagtactccttcaaagcagctgtgtcaagaaggaagagctggaaaagtggatttgctggggaattagatgcatttagttttccacttacgcacaactgccttctccagtatatcataccaaggttttttaggcctttgtggcttaccctgcaggaacatactgtgtcctgttgttctggactgtagcatcttcaccaccatcctcttggcaatggttttttgtttggggtttttttttttttttttttggacaaagtataataatattgagggacctttctagggagcctttggtcctttgtccccattttccaaagggagggaactttcctcttaaaagagacagtgggaacttttagccaggtttttggaaaaggcctgtgggctattaatgagagtgagctgcaaaaggaggaagggtttgtttgggtactttgaagtacttagctaggtgttttctacagtatcttatataattgcatcttacagcatctttacatgcgaaatagtttatcagttatcttcaattgcatattacaaaattctgattaaatttttcttaaataagaaaactatcatttcatatgacaagaaatcctaatttaatgttactccaaggttggttaattcagtggctcagtgataacaccaaagactcagtttcttgaaatttttttgctctgccatcctccatgtttatcctcacgccagttcgcctcatggtcccaatatggctactgtaattctgggaaggaaatgctgacagaaccgtgtctggcaaaagagagacagatttttctgtgtccttctaaagcaaggaagtcttcccctggaagctccaacagatacggcctcatggctttgctagaaatgggtcatctcactcctgtcattggcaaagcaagtaagatcatccatcaggagtggcttagattaatgaattatcctttgagtcgtgtagactagaaagttcagtcatgtctactagcaagaaaggagataagggctgttggataagcagcatctggtctcaaaggtacttcaacttttacagatgagaaacatgaatcagagtgactttcccaggctcacagcaagtaagagagggccttcagtgttagctgtgtctgtccctaaagcccatgttttatattgtatcttgctagagtataaagtaacttactttctaccttgtagaaactgatggtctaggagaagagatttgaactcaggtgcccagttgactctaatcttggcccatgtgagaggattgtactcagttgctctcctcatccagtgatgtttcttgtctaacacaagaagcctaggagtagaaagtcctaagcagagtagaataatagcggcagcagggagggaagtgtgaactgtgtgtccctgagcctgacttactgggcagggacatgacacttaaagcggcagctggccactctgtctttcctgcatgcactgagtatttggtagctcattagtgaccagtgatattgatcatcttttcatgtgctcacttactatccccatatctttgttgtttgcatcttttacccattgtatttgttgtttttgagacagtgtctcactctgtcacccaggctggagtgcagtctcatgatcgcggctcactgcagtttctgcctcctgggctcaagcaatcctcccacctcagcctcctgagtagctgggcttacaggcgcacaccaccatgcccagctaattaaaaaaaaaattttttttgtagcagttcggtctcattagtattgcccaggctggcctctcttagcttcaagctatcctcccgcctcggcctcccaaagtgctggaattacaggcataagccacaagccactgggcccagcctcttttacctgtttcaaaattgagttttattgagttgtaagagttctttattcattttaaacacaagtcctttgttggatatatcttttacatctatttttcccagtctgtggcttgccttttcattttgaagagcaaaagtttaaaattttgtgaatttattaaagctccgtttgttgcttttttctgttctagtttatacttttgtatcatattttaggaaattttgcactgggtatttgatggctcctgaggaggttcaactttcagagcgcactgatttctctgcacctgagattttgtactatttctgtatttctttcttctcagaacaaccagtgtcaccaggtatgagggcagagttttagcttgtttgctgagccccattcttgaagctcatttatttattcacctatctgtccatcaatccaacaaatatactgaatgctgctatgtgccaggtactggcactgttctaggtactggggcaatgacagttaagataatacccaatgaccctgctctgtacccttaagagcagactcagttgggaatgagttatccaaatatagggtgtacatgtagtcaggagagagcctcatacagctttgcctttggcagaatccttcaaacctctttgtcttcctacttcttgatattacaaatcatgagcctttcacatgcattgactctaaagaggtgggttcctggatagcagaagtagataggaaggcatcattgacatttactgagatggattgaatcagagggtgtaaattctgctccatcaatgttgaaaaagactagcccaccccaaaggtttatcactgtcaccatgtctaatgtctattctggaagaagctgaagaagtctgcctttgtttagggaaccggttccagaatcagaggggttgaggatataaaagacccttgcacaagagttggtatttaccctgtcagatgctgctaccaagatttggattgtgtacagtcgaggattaaaaatgacttttaagatgcagtgtttcatctggtgacatttaatttgatattttaaaattggggagggtattttcagccatgggggtagggatgtgaaagaagaagaaagtaagaattggagtcagatgtggttttgagtcccatacatttattgtttaatattatatggtaagtactttaaaatggtaaatagtaaatacttgtgttattcactaacatttggggaggattttctctgtgctttatgtatattacctaaccttacaaactgtgtaaggtacatgctgttctctcaatttttcagataagaaaattgaagcccagagagatcaagtgactgatccaaagtcccacagtgaggggaactgaagataggatattctttctccttttcctctttaaaaaattattttgattaaaaaaaaccgtattactgaagcatagggacatggggagaaattatgaatgattcctcagcctgaataaaatagtatgtttcattaaggcaacaaatatttattaaggacctaatatttgcctgacattcaagtgaggtggggggcacacaagtagtaaataaataacagactgggcaaagggctaccaaggcaatactgtagtagactaacaggtgccccaccatagatgggtggtccggaaaaggcgtctcagatgtctttcgttgagacgcaaaaaaaagctgtggggtagggcgtaaggggagggtggagaagagagagagggttcctggccaagggaaccaaaagcagagaagctccaagtcagaaaaaagcagcggttggcccgttgggagaattggaagccaaccagtatagctgtagcacaggcggggcccatttacgccgtgcgttttcaccctggaaaggagtttgggttttcaagtgtgacgaggcgctattaaagagttttaaacatggaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]