LOCUS       XM_046906018            1095 bp    mRNA    linear   VRT 01-MAR-2022
DEFINITION  PREDICTED: Gallus gallus apical junction molecule-like
            (LOC121112685), transcript variant X1, mRNA.
ACCESSION   XM_046906018
VERSION     XM_046906018.1
DBLINK      BioProject: PRJNA698609
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024095950.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Gallus gallus Annotation Release 106
            Annotation Version          :: 106
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 17% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1095
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /isolate="bGalGal1"
                     /db_xref="taxon:9031"
                     /chromosome="32"
                     /map="unlocalized"
                     /sex="female"
                     /tissue_type="blood"
                     /geo_loc_name="USA: Fayetteville"
                     /lat_lon="36.0822 N 94.1719 W"
                     /collection_date="20-May-2019"
                     /collected_by="Nick Anthony"
     gene            1..1095
                     /gene="LOC121112685"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 ESTs, and 92% coverage of the
                     annotated genomic feature by RNAseq alignments"
                     /db_xref="CGNC:92539"
                     /db_xref="GeneID:121112685"
     CDS             628..1095
                     /gene="LOC121112685"
                     /codon_start=1
                     /product="uncharacterized protein LOC121112685 isoform X1"
                     /protein_id="XP_046761974.1"
                     /db_xref="GeneID:121112685"
                     /db_xref="CGNC:92539"
                     /translation="

MRAQFASGTLTDLQRVNLLEELLQAHERAVEKRKAEARESLMKDAQQIREERTTATKDELDQEKQLIAQLEQQLQAGRKEIKVVWRGEGIGAARPCMGTWRATAAGTGTHAFVCQVLRQEKERLQQEREELELERCLLGTWCARGWARTAGEPAC"

     misc_feature    <658..>873
                     /gene="LOC121112685"
                     /note="recombination and DNA strand exchange inhibitor
                     protein; Reviewed; Region: PRK00409"
                     /db_xref="CDD:234750"
ORIGIN      

acagcgtgggacgacgcgccatgagagcatccaaaggggacagccgcgctgaagcgcggttgttatggatacacagccacgcgtgcgccgtcgtcacgcggacggctgtacgccgtgccatgaatgagggcgcgccgtcgccgtcgccgtcgcaacgcagctgagtgacgtcctggcagatagaacaaaccaggtgtgagcactgtctttccaaagttacactgaagccgttggaggaaaggtcggacctcaggccttcccgcggcaccaactactgacggcggatttgctcacagatccttcacagctgtttcaaagaaccattctgtgattctatgatcttccaggacccttccaagccacaccatcctgtggttctatcatcttccaggactcttccaacacaaaccattctatggttctgtgatcactaaggaacctcccaagccacgccgtcctgcagttctatgatcttccaggaccctcctgtgcgggtgatgtcacaatgatgtgatgacctcacagaggccctggggtggggcaggggcagtgggtcagcgctgaacctgcctgcctcattctgcggttggttctggtccagcgaggagctgtgcgagtggtgcagcaatgcgggcccagtttgccagcgggacattaacagatctgcagcgtgtgaatctgctggaggagctgctgcaggctcatgagcgcgccgtggagaagcgcaaggctgaggccagggaatccttgatgaaggatgcccagcaaatacgggaagaaagaacgactgccacgaaagatgagctggatcaggagaagcagctcattgcccagctggaacagcagctgcaggctgggagaaaggagatcaaggtagtgtggaggggcgagggaatcggggctgcccgcccctgcatggggacctggagggcaactgcagcgggcacgggcactcacgcttttgtctgccaggtgctgcgccaggaaaaagagcgcctgcaacaggagcgggaggagctggagcttgagaggtgcctgttgggcacatggtgtgcacgggggtgggcacgcactgctggggagcccgcgtgctga

//