LOCUS       NM_001397245             992 bp    mRNA    linear   VRT 24-SEP-2023
DEFINITION  Gallus gallus short stature homeobox (SHOX), mRNA.
ACCESSION   NM_001397245
VERSION     NM_001397245.1
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 992)
  AUTHORS   Tang H, Finn RD and Thomas PD.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 992)
  AUTHORS   Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C,
            Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 992)
  AUTHORS   Durand C, Bangs F, Signolet J, Decker E, Tickle C and Rappold G.
  TITLE     Enhancer elements upstream of the SHOX gene are active in the
            developing limb
  JOURNAL   Eur J Hum Genet 18 (5), 527-532 (2010)
   PUBMED   19997128
  REMARK    GeneRIF: SHOX upstream deletions occur at a lower frequency because
            of the structural organization of this genomic region.
REFERENCE   4  (bases 1 to 992)
  AUTHORS   Sabherwal N, Bangs F, Roth R, Weiss B, Jantz K, Tiecke E, Hinkel
            GK, Spaich C, Hauffa BP, van der Kamp H, Kapeller J, Tickle C and
            Rappold G.
  TITLE     Long-range conserved non-coding SHOX sequences regulate expression
            in developing chicken limb and are associated with short stature
            phenotypes in human patients
  JOURNAL   Hum Mol Genet 16 (2), 210-222 (2007)
   PUBMED   17200153
  REMARK    GeneRIF: Long-range conserved non-coding SHOX sequences regulate
            expression in developing chicken limb and are associated with short
            stature phenotypes in human patients.
REFERENCE   5  (bases 1 to 992)
  AUTHORS   Tiecke E, Bangs F, Blaschke R, Farrell ER, Rappold G and Tickle C.
  TITLE     Expression of the short stature homeobox gene Shox is restricted by
            proximal and distal signals in chick limb buds and affects the
            length of skeletal elements
  JOURNAL   Dev Biol 298 (2), 585-596 (2006)
   PUBMED   16904661
  REMARK    GeneRIF: These results fit well with the proposed role of Shox in
            cartilage and bone differentiation and suggest chick embryos as a
            useful model to study further the role of Shox in limb development.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAENSK010000025.1 and DQ675517.1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: DQ675517.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA3109050, SAMEA3109051
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-199               JAENSK010000025.1  1969266-1969464     c
            200-992             DQ675517.1         118-910
FEATURES             Location/Qualifiers
     source          1..992
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="1"
                     /map="1"
     gene            1..992
                     /gene="SHOX"
                     /note="short stature homeobox"
                     /db_xref="CGNC:50824"
                     /db_xref="GeneID:418669"
     exon            1..385
                     /gene="SHOX"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    19..21
                     /gene="SHOX"
                     /note="upstream in-frame stop codon"
     CDS             115..987
                     /gene="SHOX"
                     /codon_start=1
                     /product="short stature homeobox protein"
                     /protein_id="NP_001384174.1"
                     /db_xref="CGNC:50824"
                     /db_xref="GeneID:418669"
                     /translation="

MEELTAFVSKSFDQKSKESGGGGGGGNKETITYREVLESGLARSRELGNSDSALPDMTEGSNHCPVHLFKDHVESDKDKLKEFAAGRTAEGIYECKEKREDVKSEDEDGQTKLKQRRSRTNFTLEQLNELERLFDETHYPDAFMREELSQRLGLSEARVQVWFQNRRAKCRKQENQMHKGVILGTASHLDACRVAPYVNMGALRMPFQQVQAQLQLEGVAHAHPHLHPHLAAHAPYLMFPPPPFGLPIASLAESASAAAVVAAAAKSNSKNSSIADLRLKARKHAEALGL"

     misc_feature    460..630
                     /gene="SHOX"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    922..972
                     /gene="SHOX"
                     /note="OAR motif; Region: OAR; pfam03826"
                     /db_xref="CDD:461067"
     exon            386..594
                     /gene="SHOX"
                     /inference="alignment:Splign:2.1.0"
     exon            595..652
                     /gene="SHOX"
                     /inference="alignment:Splign:2.1.0"
     exon            653..741
                     /gene="SHOX"
                     /inference="alignment:Splign:2.1.0"
     exon            742..992
                     /gene="SHOX"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

cataaataacagcgggagtgagctcaccccgcacagcccatcttccgccgcacgctgcgtgcggggagcgcggccgaggccgggggatccgtgtggatagcagcgcgggcagccatggaagaactcacggcttttgtatccaaatctttcgaccagaaaagcaaagagagcggcggcggcggcggcggcggcaacaaggagaccatcacgtaccgggaagttttggagagtgggttggctcgctccagggagcttgggaactccgattcggcgctgccggacatgaccgagggcagcaatcattgccccgtgcaccttttcaaggaccacgtagaaagcgacaaggacaagctgaaggagttcgcggcgggcaggacggcggaagggatctacgagtgcaaggagaagcgggaggacgtgaagtcggaggacgaggacggccagaccaagctgaaacaaaggagaagcagaaccaatttcacactagagcagctgaacgagctggaaagactttttgatgagactcactacccggatgccttcatgcgggaggaactaagccagaggctgggactgtctgaagctagggtgcaggtctggttccagaacaggagagccaagtgccgaaagcaggagaaccagatgcacaaaggtgtgatcttgggcaccgccagccacttagacgcctgcagagtggccccgtacgtcaatatgggagccctgaggatgcctttccaacaggtccaggctcagctgcagctggagggagtggcccacgcacacccgcacctgcacccgcacctggcggcccacgcgccctacctgatgttcccacctccgcccttcgggctgcccatcgcctccctggcggagtccgcctccgccgccgccgtggtggccgcagccgccaagagcaacagcaagaactccagcatcgccgacctgcggctgaaggcccgcaagcacgccgaggccctggggctctgacacgc

//