LOCUS       NM_001277810            1990 bp    mRNA    linear   VRT 19-SEP-2023
DEFINITION  Gallus gallus selenium binding protein 1 (SELENBP1), mRNA.
ACCESSION   NM_001277810 XM_003642693
VERSION     NM_001277810.1
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1990)
  AUTHORS   Tang H, Finn RD and Thomas PD.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1990)
  AUTHORS   Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C,
            Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1990)
  AUTHORS   Ahanda ML, Ruby T, Wittzell H, Bed'Hom B, Chausse AM, Morin V,
            Oudin A, Chevalier C, Young JR and Zoorob R.
  TITLE     Non-coding RNAs revealed during identification of genes involved in
            chicken immune responses
  JOURNAL   Immunogenetics 61 (1), 55-70 (2009)
   PUBMED   19009289
REFERENCE   4  (bases 1 to 1990)
  AUTHORS   Carre W, Wang X, Porter TE, Nys Y, Tang J, Bernberg E, Morgan R,
            Burnside J, Aggrey SE, Simon J and Cogburn LA.
  TITLE     Chicken genomics resource: sequencing and annotation of 35,407 ESTs
            from single and multiple tissue cDNA libraries and CAP3 assembly of
            a chicken gene index
  JOURNAL   Physiol Genomics 25 (3), 514-524 (2006)
   PUBMED   16554550
REFERENCE   5  (bases 1 to 1990)
  AUTHORS   Boardman PE, Sanz-Ezquerro J, Overton IM, Burt DW, Bosch E, Fong
            WT, Tickle C, Brown WR, Wilson SA and Hubbard SJ.
  TITLE     A comprehensive collection of chicken cDNAs
  JOURNAL   Curr Biol 12 (22), 1965-1969 (2002)
   PUBMED   12445392
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BM489788.1, BX935001.2, BI065449.1, BU445053.1, CF250995.1 and
            BU415457.1.
            
            On Apr 20, 2013 this sequence version replaced XM_003642693.1.
            
            Sequence Note: This RefSeq record was created from transcript data
            from different strains because no single transcript from the same
            strain was available for the full length of the gene. The extent of
            this transcript is supported by transcript alignments and
            orthologous data.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed sample support SAMEA103992290,
                              SAMEA103992323 [ECO:0006172]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-8                 BM489788.1         1-8
            9-104               BX935001.2         2-97
            105-572             BI065449.1         99-566
            573-695             BX935001.2         566-688
            696-781             BU445053.1         689-774
            782-998             BX935001.2         775-991
            999-1117            CF250995.1         535-653
            1118-1298           BX935001.2         1111-1291
            1299-1482           BU415457.1         15-198
            1483-1528           BX935001.2         1476-1521
            1529-1530           BU415457.1         244-245
            1531-1810           BX935001.2         1526-1805
            1811-1845           BU415457.1         527-561
            1846-1917           BX935001.2         1841-1912
            1918-1939           BU415457.1         635-656
            1940-1990           BX935001.2         1935-1985
FEATURES             Location/Qualifiers
     source          1..1990
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="25"
                     /map="25"
     gene            1..1990
                     /gene="SELENBP1"
                     /note="selenium binding protein 1"
                     /db_xref="CGNC:52529"
                     /db_xref="GeneID:425664"
     exon            1..40
                     /gene="SELENBP1"
                     /inference="alignment:Splign:2.1.0"
     CDS             37..1452
                     /gene="SELENBP1"
                     /EC_number="1.8.3.4"
                     /note="selenium-binding protein 1-A-like"
                     /codon_start=1
                     /product="methanethiol oxidase"
                     /protein_id="NP_001264739.1"
                     /db_xref="CGNC:52529"
                     /db_xref="GeneID:425664"
                     /translation="

MAKCGACGPGYATPLDAMKGPREEIVYLPCIYRNTGIQKPDYLATVDVDPKSPHYCQVIHRLPMPNLKDELHHSGWNACSSCFGDTTKSRNRLILPCLISSRIYVVDVGTDPRAPRIHKTVEPVELFWKGNVANPHTSHCLGSGDILISCLGDPSGNGKGGFVLLDGETFEVKGNWEKGGKCPPFGYDFWYQPRHNVLISTEWGAPKVLAYGFNPVDVENGHYGRRINVWDWSSHTYLQAIDLGKDSIPLEIRFLHNPDAAEGFVGCALSGTVHRFYKTEKGDWAAEKVIEVPRKKVQGWLLPDMPGLITDILISLDDRFLYFSNWLHGDIRQYDISNTRQPKLVGQVFLGGSIVRGGPVTVVEDKELQCQPEPFVIKGKRVQGGPQMIQLSLDGKRLYVSTSLYSGWDKQFYPDLVKEGSVMLQVDVDTERGGLKVNTNFLVDFGKEPDGPALAHEIRYPGGDSTSDIWI"

     misc_feature    55..1449
                     /gene="SELENBP1"
                     /note="56kDa selenium binding protein (SBP56); Region:
                     SBP56; pfam05694"
                     /db_xref="CDD:461716"
     exon            41..94
                     /gene="SELENBP1"
                     /inference="alignment:Splign:2.1.0"
     exon            95..207
                     /gene="SELENBP1"
                     /inference="alignment:Splign:2.1.0"
     exon            208..393
                     /gene="SELENBP1"
                     /inference="alignment:Splign:2.1.0"
     exon            394..514
                     /gene="SELENBP1"
                     /inference="alignment:Splign:2.1.0"
     exon            515..697
                     /gene="SELENBP1"
                     /inference="alignment:Splign:2.1.0"
     exon            698..876
                     /gene="SELENBP1"
                     /inference="alignment:Splign:2.1.0"
     exon            877..955
                     /gene="SELENBP1"
                     /inference="alignment:Splign:2.1.0"
     exon            956..1077
                     /gene="SELENBP1"
                     /inference="alignment:Splign:2.1.0"
     exon            1078..1170
                     /gene="SELENBP1"
                     /inference="alignment:Splign:2.1.0"
     exon            1171..1289
                     /gene="SELENBP1"
                     /inference="alignment:Splign:2.1.0"
     exon            1290..1990
                     /gene="SELENBP1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

ggcgctgtgcttcctgctgcgcacctcggagccaacatggcaaaatgcggagcgtgcggcccaggatacgcaactcccctggacgccatgaaaggtccccgggaggagattgtctacctgccctgcatctacaggaacaccggcatccagaagccggactacctggccactgtggatgttgaccccaaatccccacactattgccaggtcatccaccgcctgcccatgcccaacctgaaagacgagctccatcactcggggtggaacgcctgcagcagctgctttggggacaccacaaagagtcgcaatcgtctcattctcccatgcctgatctcatcccgcatttacgtggtggatgtgggcacagacccacgagcccccagaatccataagactgtggagcctgtggagctgttctggaaggggaacgtggcaaatccccacacctcccactgtctgggcagcggtgacatcctgatcagctgcttgggagatccttctggcaatgggaaaggtggctttgttttgctggatggagagacctttgaagtgaagggtaattgggagaaaggagggaagtgccctccctttggttacgacttctggtaccaaccacggcacaacgtcctgataagcactgagtggggggcccccaaagtcctggcatatgggtttaacccagtggatgtcgagaacgggcattacggccgccgcatcaacgtgtgggactggagctcccacacctaccttcaggcaattgacctagggaaggactccatccctctggaaattcggttcctccacaaccctgatgctgcagaaggatttgttggatgcgctctgagcggaaccgtgcatcgcttctacaagacagagaaaggagactgggcagcagagaaggtgattgaagtacccagaaagaaagtgcagggatggctcctccctgacatgcctggtctcatcactgacatcctcatctcgctggacgacagatttctctacttcagcaattggctgcatggcgacatccgtcagtatgacatctccaacacgcgccagcccaaactggtggggcaggtgttcctgggaggcagcatcgtaagaggtggacctgtgactgtggtggaagacaaggagctgcagtgccaaccagagccgtttgtgatcaaagggaagagggtgcagggcggaccgcagatgattcagctcagtttggatgggaagaggctgtacgtctccacctctctctacagcggatgggacaaacagttctacccagatcttgtcaaggagggctctgttatgctgcaggtcgatgtggacactgaaagaggtggattgaaagtcaatacaaacttcctggtggattttgggaaggagcccgacgggccggcgctggctcatgagattcgttaccccggtggtgacagcacctcggacatctggatataagtgtgtatggagctgttttcttggctggtttgttgttattattgatttctcggttgattctcttatatccccccccaaccaccctccccgcccctttcctgcaggtgaatcagtccagcgaaccactttctgaatttttacttccatgggggtgagccacagaagctccgctttatgctcattctctgaggcagccaagtaaacctgaaacacgtcctacatctctttcatttccctgatctgtgcctttataaagagctgtgcaatcactaactgcctgtaggccgacctcacagttggcaccgactgtttgctgggtggtggaggagccgctcctgggtaactccagaagtgcacactgcacagagtgccctttccctgcaaagcttaatttgctcatcgagtaatcagtgatttacagcacaaaatcacgcactactaacccgaagccacgcgtttcctgagatgggttttcttttaacattggtgcaccaatgctgtataaaaaaattaacaataaaatcattctttgaatcag

//