2024-11-01 12:41:08, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS XR_011016228 1028 bp RNA linear VRT 08-SEP-2024 DEFINITION PREDICTED: Danio rerio uncharacterized lncRNA (LOC137496124), ncRNA. ACCESSION XR_011016228 VERSION XR_011016228.1 DBLINK BioProject: PRJNA13922 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_007118.7) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_000002035.6-RS_2024_08 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 08/15/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1028 /organism="Danio rerio" /mol_type="transcribed RNA" /strain="Tuebingen" /db_xref="taxon:7955" /chromosome="7" gene 1..1028 /gene="LOC137496124" /note="uncharacterized LOC137496124; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 9 samples with support for all annotated introns" /db_xref="GeneID:137496124" ncRNA 1..1028 /ncRNA_class="lncRNA" /gene="LOC137496124" /product="uncharacterized lncRNA" /db_xref="GeneID:137496124" ORIGIN
ggatggatgggtggacagacaaacagacagacaaagagaaggatggatggatggatgtgtagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatgtagaaatacatagatggatgggtagagtgatggacagatgttcagtagatgaatagatagatgggtagatgcatacagttatgtataaatggcacattagtagataagggtaaacagatgacaagaagagattgatcaagctttaagactgaataagagtcatatagaagagtctaataaatagagagaaggttctagggttagctggatggacggatggatgattcaccattagacatgtgggagcttgatagatgagtatgaatggacagcggcacttttctgtaacactgttgactgttatcttatacttgtttcccccatcttctacatgtttcctaaacagcaggaagaaccggccgacaccagggtggagtatagactcactggagcagtgtcacatttaggaagcaaactgttttctggacactacataagtcacattcgggatccaagtgacgatggatggctgcgttgcagtgacttttccgtcaggaaaatcagctggacagaagcgtccgaagaaataaagaggaactgctacatgctgttctacatcaagcgatgagcagcagtttgtagccgacagtcctgaagaggtggagaacagcagactgagcttcagaagatccagagtcagaagattctgccagatacttgcaccaaaacccccctgagagcttcagaacacacatgaagatattttggattaaatcagagagctcctgaccctcatataaaggaaacattcatgttactccacccttgctgtatatggagggtcaggggacagatgaatgaaaggctgaacagtttggaactatatgagtgcaagtaaatgatggcagatttgatgtgaactgtaacttgagcactgcaatcaataaaaattatttttccaat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]