LOCUS       XM_021469726             930 bp    mRNA    linear   VRT 15-JUN-2017
DEFINITION  PREDICTED: Danio rerio homeobox C5a (hoxc5a), transcript variant
            X1, mRNA.
ACCESSION   XM_021469726
VERSION     XM_021469726.1
DBLINK      BioProject: PRJNA13922
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_007134.7) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Danio rerio Annotation Release 106
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..930
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="23"
     gene            1..930
                     /gene="hoxc5a"
                     /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25"
                     /note="homeobox C5a; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 1 EST, and 100% coverage
                     of the annotated genomic feature by RNAseq alignments,
                     including 35 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:30379"
                     /db_xref="ZFIN:ZDB-GENE-980526-533"
     CDS             340..846
                     /gene="hoxc5a"
                     /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25"
                     /codon_start=1
                     /product="homeobox protein Hox-C5a isoform X1"
                     /protein_id="XP_021325401.1"
                     /db_xref="GeneID:30379"
                     /db_xref="ZFIN:ZDB-GENE-980526-533"
                     /translation="

MSSYVGKSFSKQTQDASSCRMHTFDNYGAHSEFHESNYAYEGLDLGGSFSSQIPTNSLRREAINTTDRARSSAAVQRTQSCSALGSRSFVSTHGYNPLSHGLLSQKAEGNMEVMEKPSGKSRTDDIKMETTSAIKQQTNSTQRQNQSQPQIYPWMTKLHMSHGNPVSF"

ORIGIN      

tccataccgagaagttatcggacacgtttccctgtctatcaataacctcctggggatcaagccaatttatgactggccaggagctgcacgtgattctatttaaacattccatatttgggcattacacgtcgtaccaagaaaaaaagaaaatgatttcctccacctataaatcctgctcttttttaggacaagcctaacgtcctctagaaatacaaataaagccaataaacaaatacaacttctaaacaacttatgtatactttattagctgatttcgtttctgcagtgaccgagtgttatttgtgagtctctttagggtgatattgtttgggaaatagcatgagctcatacgttgggaagtctttttctaagcagacgcaagacgcctcctcttgtagaatgcacacttttgacaactatggagctcacagtgagttccacgagtccaattacgcgtacgaagggcttgatctcggcggatccttcagttctcaaatccccaccaactctttgaggcgggaggcgataaacacaaccgaccgtgcaaggagcagtgcagcagttcagcgaacacagtcttgttcagctctgggctctcgtagctttgtaagcactcacgggtacaaccccctcagtcacggactgttgagccaaaaagccgaggggaatatggaagttatggagaagcccagcggcaagagccgcacagacgatatcaaaatggagactacttcagcgataaagcaacaaactaattcgactcagcgtcagaaccagtcgcagccgcagatatatccgtggatgacaaagctacacatgagccacggtaacccagtatctttctgatgccatctcagaatctgacggtaaaaggtcacgaaccagttacacccggtaccagactctggagttggagaaagagttccattt

//