2024-11-01 12:30:43, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS NM_173232 702 bp mRNA linear VRT 08-OCT-2023 DEFINITION Danio rerio ribosomal protein S5 (rps5), mRNA. ACCESSION NM_173232 VERSION NM_173232.1 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. REFERENCE 1 (bases 1 to 702) AUTHORS Honkoop H, de Bakker DE, Aharonov A, Kruse F, Shakked A, Nguyen PD, de Heus C, Garric L, Muraro MJ, Shoffner A, Tessadori F, Peterson JC, Noort W, Bertozzi A, Weidinger G, Posthuma G, Grun D, van der Laarse WJ, Klumperman J, Jaspers RT, Poss KD, van Oudenaarden A, Tzahor E and Bakkers J. TITLE Single-cell analysis uncovers that metabolic reprogramming by ErbB2 signaling is essential for cardiomyocyte proliferation in the regenerating heart JOURNAL Elife 8, e50163 (2019) PUBMED 31868166 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 702) AUTHORS Cheung CT, Nguyen TV, Le Cam A, Patinote A, Journot L, Reynes C and Bobe J. TITLE What makes a bad egg? Egg transcriptome reveals dysregulation of translational machinery and novel fertility genes important for fertilization JOURNAL BMC Genomics 20 (1), 584 (2019) PUBMED 31307377 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 702) AUTHORS Bayes A, Collins MO, Reig-Viader R, Gou G, Goulding D, Izquierdo A, Choudhary JS, Emes RD and Grant SG. TITLE Evolution of complexity in the zebrafish synapse proteome JOURNAL Nat Commun 8, 14613 (2017) PUBMED 28252024 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 702) AUTHORS Pasquier J, Cabau C, Nguyen T, Jouanno E, Severac D, Braasch I, Journot L, Pontarotti P, Klopp C, Postlethwait JH, Guiguen Y and Bobe J. TITLE Gene evolution and gene expression after whole genome duplication in fish: the PhyloFish database JOURNAL BMC Genomics 17, 368 (2016) PUBMED 27189481 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 702) AUTHORS Elkon R, Milon B, Morrison L, Shah M, Vijayakumar S, Racherla M, Leitch CC, Silipino L, Hadi S, Weiss-Gayet M, Barras E, Schmid CD, Ait-Lounis A, Barnes A, Song Y, Eisenman DJ, Eliyahu E, Frolenkov GI, Strome SE, Durand B, Zaghloul NA, Jones SM, Reith W and Hertzano R. TITLE RFX transcription factors are essential for hearing in mice JOURNAL Nat Commun 6, 8549 (2015) PUBMED 26469318 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 702) AUTHORS Aanes H, Winata C, Moen LF, Ostrup O, Mathavan S, Collas P, Rognes T and Alestrom P. TITLE Normalization of RNA-sequencing data from samples with varying mRNA levels JOURNAL PLoS One 9 (2), e89158 (2014) PUBMED 24586560 REMARK Publication Status: Online-Only REFERENCE 7 (bases 1 to 702) AUTHORS Lai K, Amsterdam A, Farrington S, Bronson RT, Hopkins N and Lees JA. TITLE Many ribosomal protein mutations are associated with growth impairment and tumor predisposition in zebrafish JOURNAL Dev Dyn 238 (1), 76-85 (2009) PUBMED 19097187 REFERENCE 8 (bases 1 to 702) AUTHORS MacInnes AW, Amsterdam A, Whittaker CA, Hopkins N and Lees JA. TITLE Loss of p53 synthesis in zebrafish tumors with ribosomal protein gene mutations JOURNAL Proc Natl Acad Sci U S A 105 (30), 10408-10413 (2008) PUBMED 18641120 REFERENCE 9 (bases 1 to 702) AUTHORS Linney E, Dobbs-McAuliffe B, Sajadi H and Malek RL. TITLE Microarray gene expression profiling during the segmentation phase of zebrafish development JOURNAL Comp Biochem Physiol C Toxicol Pharmacol 138 (3), 351-362 (2004) PUBMED 15533793 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AF506223.1. ##Evidence-Data-START## Transcript exon combination :: AF506223.1, CT639061.2 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA3505370, SAMEA3505371 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..702 /organism="Danio rerio" /mol_type="mRNA" /db_xref="taxon:7955" /chromosome="15" /map="15" gene 1..702 /gene="rps5" /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05; wu:fj57h03" /note="ribosomal protein S5" /db_xref="GeneID:192297" /db_xref="ZFIN:ZDB-GENE-020419-12" exon 1..33 /gene="rps5" /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05; wu:fj57h03" /inference="alignment:Splign:2.1.0" CDS 34..648 /gene="rps5" /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05; wu:fj57h03" /codon_start=1 /product="40S ribosomal protein S5" /protein_id="NP_775339.1" /db_xref="GeneID:192297" /db_xref="ZFIN:ZDB-GENE-020419-12" /translation="
MAEDWEAAPAVAETPEIKLFGKWSTDDVQINDISLQDYIAVKEKYAKYLPHSSGRYAAKRFRKAQCPIVERVTNSMMMHGRNNGKKLLTVRIVKHAFEIIHLLTGENPLQILVNAIINSGPREDSTRIGRAGTVRRQAVDVSPLRRVNQAIWLLCTGAREAAFRNIKTIAECLADELINAAKGSYNSYAIKKKDELERVAKSNR"
misc_feature 85..645 /gene="rps5" /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05; wu:fj57h03" /note="Eukaryota homolog of Ribosomal Protein S7; Region: uS7_Eukaryote; cd14867" /db_xref="CDD:271246" misc_feature order(85..87,172..180,184..195,292..294,304..306) /gene="rps5" /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05; wu:fj57h03" /note="S9 interface [polypeptide binding]; other site" /db_xref="CDD:271246" misc_feature order(184..186,190..192,202..213,220..222,244..246, 253..255,259..273,283..297,304..306,424..432,436..438, 466..468,487..489,508..510,517..519,535..540) /gene="rps5" /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05; wu:fj57h03" /note="rRNA binding site [nucleotide binding]; other site" /db_xref="CDD:271246" misc_feature order(316..318,325..330,337..339,535..537,541..546) /gene="rps5" /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05; wu:fj57h03" /note="S25 interface [polypeptide binding]; other site" /db_xref="CDD:271246" misc_feature order(421..423,430..432,436..438,643..645) /gene="rps5" /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05; wu:fj57h03" /note="S11 interface [polypeptide binding]; other site" /db_xref="CDD:271246" exon 34..141 /gene="rps5" /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05; wu:fj57h03" /inference="alignment:Splign:2.1.0" exon 142..351 /gene="rps5" /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05; wu:fj57h03" /inference="alignment:Splign:2.1.0" exon 352..480 /gene="rps5" /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05; wu:fj57h03" /inference="alignment:Splign:2.1.0" exon 481..579 /gene="rps5" /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05; wu:fj57h03" /inference="alignment:Splign:2.1.0" exon 580..700 /gene="rps5" /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05; wu:fj57h03" /inference="alignment:Splign:2.1.0" ORIGIN
ctcgagtgcgccattcacacacacgctgcgaagatggctgaagattgggaggctgcaccagctgttgctgaaaccccagagatcaaactctttggcaagtggagcacagatgatgtacagatcaatgacatctccctgcaggattacattgccgtgaaggagaaatacgccaaatacctccctcattccagcggcagatacgcagccaagcgtttccgtaaggctcagtgtcccattgtggagcgcgtcactaactccatgatgatgcacggacgcaacaacggcaagaaactgctgaccgttcgcatcgtcaagcacgcttttgagatcatccacctgctcactggcgagaatcctctgcagattctggtaaacgccatcatcaacagtggccctcgtgaggactccacccgtatcggacgtgctggaaccgtgaggagacaggctgttgatgtgtcccccctgcgcagagtcaaccaggccatctggctgctctgcactggtgcaagagaagctgctttcaggaacatcaagaccatcgcagagtgtcttgctgacgagctcatcaacgctgccaagggttcctacaactcttacgccatcaagaagaaagatgagctggagagagtggccaagtctaaccgctaatctccattttgtataaaatcggattacattaaaagaggaagagttaaacctaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]