2024-11-01 10:10:59, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS NM_001166140 819 bp mRNA linear VRT 06-JUL-2017 DEFINITION Danio rerio NK6 homeobox 3 (nkx6.3), mRNA. ACCESSION NM_001166140 XM_679812 VERSION NM_001166140.1 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. REFERENCE 1 (bases 1 to 819) AUTHORS Malmquist SJ, Abramsson A, McGraw HF, Linbo TH and Raible DW. TITLE Modulation of dorsal root ganglion development by ErbB signaling and the scaffold protein Sorbs3 JOURNAL Development 140 (19), 3986-3996 (2013) PUBMED 24004948 REMARK Erratum:[Development. 2017 Jan 1;144(1):173. PMID: 27979883] REFERENCE 2 (bases 1 to 819) AUTHORS Wotton KR, Weierud FK, Juarez-Morales JL, Alvares LE, Dietrich S and Lewis KE. TITLE Conservation of gene linkage in dispersed vertebrate NK homeobox clusters JOURNAL Dev. Genes Evol. 219 (9-10), 481-496 (2009) PUBMED 20112453 REFERENCE 3 (bases 1 to 819) AUTHORS Hutchinson SA, Cheesman SE, Hale LA, Boone JQ and Eisen JS. TITLE Nkx6 proteins specify one zebrafish primary motoneuron subtype by regulating late islet1 expression JOURNAL Development 134 (9), 1671-1677 (2007) PUBMED 17376808 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from BX571947.8. On May 21, 2010 this sequence version replaced XM_679812.1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns SAMEA2168446, SAMEA2168447 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-418 BX571947.8 174912-175329 c 419-588 BX571947.8 173093-173262 c 589-819 BX571947.8 172655-172885 c FEATURES Location/Qualifiers source 1..819 /organism="Danio rerio" /mol_type="mRNA" /strain="Tuebingen" /db_xref="taxon:7955" /chromosome="8" /map="8" gene 1..819 /gene="nkx6.3" /note="NK6 homeobox 3" /db_xref="GeneID:558978" /db_xref="ZFIN:ZDB-GENE-070810-7" CDS 1..819 /gene="nkx6.3" /note="transcription factor Nkx6.3" /codon_start=1 /product="homeobox protein Nkx-6.3" /protein_id="NP_001159612.1" /db_xref="GeneID:558978" /db_xref="ZFIN:ZDB-GENE-070810-7" /translation="
MESNISGSFLFNNSLNQFPSDIKAPVCQYSIPNSFYKLGPANINSQLQAGTPHGISDILSRSMVSGPGTPALLSGYPSMGGFGTTVPSPGVYYNRDYTPSGLSTFPKPVVECAGMKGKSSSCWVDGGYEWRGARQQCGNNMGHNPENVGKKKHTRPTFSGHQIFALEKTFEQTKYLAGPERARLAYSLGMTESQVKVWFQNRRTKWRKKSATEPSSTQTSRGESAGDGSENEVEDEEYNKPLDPDTDDEKIRQLLRKHRRAFSVLRLGPHHI"
misc_feature 448..624 /gene="nkx6.3" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" ORIGIN
atggagtccaacatctcaggatccttcctctttaacaacagcttgaaccaatttccgtcagacatcaaggccccggtgtgccagtactccattcccaactccttctacaagcttggccctgccaatatcaactcacagttacaggctggcactccgcatggcatcagtgacattctgagtcgatccatggtgagcggtccaggaacccctgcactattgtctgggtacccatccatgggtggctttggaacaactgttcccagtccgggggtgtattataatcgggattacaccccatcaggactgagcacttttcctaaacctgttgtcgaatgtgcaggtatgaagggtaaaagcagcagctgctgggtggatggagggtatgagtggagaggcgcgagacagcagtgtggcaacaatatggggcataatcctgagaatgtggggaaaaaaaagcacacacgacctacattcagtgggcatcagatctttgctctggagaaaacctttgaacagaccaagtatttggcaggaccagagagagccagactggcatactcgctagggatgactgagtcacaagttaaagtgtggttccagaatcggcgtactaaatggcggaaaaagagcgcaacggagcccagttccacacagacctcgcgtggggagagtgcaggagacgggtcggaaaatgaggtggaggacgaggagtacaacaaacctctggaccccgacacagacgatgagaagatacgacagctgctgcgcaaacaccgcagagctttctcagtactgcgcctggggccacaccatatctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]