2024-11-01 12:46:30, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS NM_001020506 918 bp mRNA linear VRT 16-SEP-2023 DEFINITION Danio rerio taste receptor, type 2, member 203 (tas2r203), mRNA. ACCESSION NM_001020506 VERSION NM_001020506.1 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. REFERENCE 1 (bases 1 to 918) AUTHORS Kowatschew D and Korsching SI. TITLE An Ancient Adenosine Receptor Gains Olfactory Function in Bony Vertebrates JOURNAL Genome Biol Evol 13 (9) (2021) PUBMED 34499158 REFERENCE 2 (bases 1 to 918) AUTHORS Behrens M, Di Pizio A, Redel U, Meyerhof W and Korsching SI. TITLE At the Root of T2R Gene Evolution: Recognition Profiles of Coelacanth and Zebrafish Bitter Receptors JOURNAL Genome Biol Evol 13 (1) (2021) PUBMED 33355666 REFERENCE 3 (bases 1 to 918) AUTHORS Ohmoto M, Okada S, Nakamura S, Abe K and Matsumoto I. TITLE Mutually exclusive expression of Galphaia and Galpha14 reveals diversification of taste receptor cells in zebrafish JOURNAL J Comp Neurol 519 (8), 1616-1629 (2011) PUBMED 21452212 REFERENCE 4 (bases 1 to 918) AUTHORS Oike H, Nagai T, Furuyama A, Okada S, Aihara Y, Ishimaru Y, Marui T, Matsumoto I, Misaka T and Abe K. TITLE Characterization of ligands for fish taste receptors JOURNAL J Neurosci 27 (21), 5584-5592 (2007) PUBMED 17522303 REFERENCE 5 (bases 1 to 918) AUTHORS Go Y. CONSRTM SMBE Tri-National Young Investigators TITLE Proceedings of the SMBE Tri-National Young Investigators' Workshop 2005. Lineage-specific expansions and contractions of the bitter taste receptor gene repertoire in vertebrates JOURNAL Mol Biol Evol 23 (5), 964-972 (2006) PUBMED 16484289 REFERENCE 6 (bases 1 to 918) AUTHORS Ishimaru Y, Okada S, Naito H, Nagai T, Yasuoka A, Matsumoto I and Abe K. TITLE Two families of candidate taste receptors in fishes JOURNAL Mech Dev 122 (12), 1310-1321 (2005) PUBMED 16274966 REFERENCE 7 (bases 1 to 918) AUTHORS Pfister P and Rodriguez I. TITLE Olfactory expression of a single and highly variable V1r pheromone receptor-like gene in fish species JOURNAL Proc Natl Acad Sci U S A 102 (15), 5489-5494 (2005) PUBMED 15809442 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AY764272.1. FEATURES Location/Qualifiers source 1..918 /organism="Danio rerio" /mol_type="mRNA" /db_xref="taxon:7955" /chromosome="9" /map="9" gene 1..918 /gene="tas2r203" /gene_synonym="T2R1; tas2r1l; tas2r4" /note="taste receptor, type 2, member 203" /db_xref="GeneID:553135" /db_xref="ZFIN:ZDB-GENE-050510-3" CDS 1..918 /gene="tas2r203" /gene_synonym="T2R1; tas2r1l; tas2r4" /note="taste receptor, type 2, member 4; bitter taste receptor; taste receptor, type 2, member 1 like; zfT2R4" /codon_start=1 /product="taste receptor, type 2, member 203" /protein_id="NP_001018342.1" /db_xref="GeneID:553135" /db_xref="ZFIN:ZDB-GENE-050510-3" /translation="
MEPWLYALISSPLCLIGMVFNLLFFFCLMRPVSGVTLRNPLRFLLIVVLVNSTFQYLVIAVTIIMLLFDYIFWLETVTRALIYQFFCGNFLCNAWISIFYYISIVPQHHAIFIWIKRNIKAILYGGFILNQIVLTFAISTGAVTYFFLGPVPVNFTALELNSTALAQTLEADMFLFHVANFSYLLYCTCPLVTLIVSWGKTFFYLRGHMKKMGQSGESFSQPQQKSQMRVTVTGMVQAALFLPSSLWTVAAALLYITGLFEEVDPSRFITMTFCSLSSLGNLLCFGFSQSVFRRGIVSVIKKLKG"
misc_feature 160..>669 /gene="tas2r203" /gene_synonym="T2R1; tas2r1l; tas2r4" /note="seven-transmembrane G protein-coupled receptor superfamily; Region: 7tm_GPCRs; cl28897" /db_xref="CDD:475119" misc_feature 235..294 /gene="tas2r203" /gene_synonym="T2R1; tas2r1l; tas2r4" /note="TM helix 3 [structural motif]; Region: TM helix 3" /db_xref="CDD:410628" misc_feature 379..429 /gene="tas2r203" /gene_synonym="T2R1; tas2r1l; tas2r4" /note="TM helix 4 [structural motif]; Region: TM helix 4" /db_xref="CDD:410628" misc_feature 517..597 /gene="tas2r203" /gene_synonym="T2R1; tas2r1l; tas2r4" /note="TM helix 5 [structural motif]; Region: TM helix 5" /db_xref="CDD:410628" exon 1..918 /gene="tas2r203" /gene_synonym="T2R1; tas2r1l; tas2r4" /inference="alignment:Splign:2.1.0" ORIGIN
atggagccatggctgtacgctttaatctccagtcccctctgcctcataggcatggttttcaacctcctcttctttttctgcctcatgcggccagtctccggagtgacgcttcgtaatccactgcgcttcttgttaattgttgtgctcgtcaattctacatttcaatatctggtcatagccgtgaccattattatgcttctttttgattacattttctggctggaaacagttaccagagctctgatttatcaattcttttgcggaaacttcttgtgcaatgcctggatcagcattttctactacatatcaattgttcctcaacatcatgccatcttcatctggattaagaggaatattaaagctattttatatgggggcttcattctaaatcaaatagtgcttacgtttgctatatctacgggggcagtgacatatttttttcttgggcccgtcccagttaattttactgcacttgaactgaactcaacagcactagcacaaaccttagaggcagacatgtttttgtttcatgtggcaaatttttcatatttgctatattgcacctgcccgttggtcacactgatagtctcttggggcaaaacttttttttatctgcgtggacatatgaaaaagatgggacagagcggcgagtctttttcccagccccagcagaagagccagatgcgagtcacagtgacaggtatggtgcaggcagcactgttcctacccagtagcctgtggacagtagcagctgctctcctctacattacaggcctctttgaagaggtggatcccagcaggtttatcacaatgactttctgctcactgtccagcttgggaaatctgctgtgtttcggattctcccagtctgtgtttcgccgtgggattgtaagtgtgattaaaaagctaaaaggttga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]