2025-09-16 15:03:57, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XM_026837967 1573 bp mRNA linear INV 22-OCT-2018 DEFINITION PREDICTED: Ciona intestinalis Myc-induced nuclear antigen with a molecular mass of 53 kDa-like 1 (mina53-like1), transcript variant X2, mRNA. ACCESSION XM_026837967 VERSION XM_026837967.1 DBLINK BioProject: PRJNA187185 KEYWORDS RefSeq. SOURCE Ciona intestinalis (vase tunicate) ORGANISM Ciona intestinalis Eukaryota; Metazoa; Chordata; Tunicata; Ascidiacea; Phlebobranchia; Cionidae; Ciona. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_004190363.2) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Ciona intestinalis Annotation Release 104 Annotation Version :: 104 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1573 /organism="Ciona intestinalis" /mol_type="mRNA" /db_xref="taxon:7719" /chromosome="Unknown" gene 1..1573 /gene="mina53-like1" /note="Myc-induced nuclear antigen with a molecular mass of 53 kDa-like 1; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 48 ESTs, 1 Protein, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 39 samples with support for all annotated introns" /db_xref="GeneID:494417" CDS 103..1440 /gene="mina53-like1" /codon_start=1 /product="myc-induced nuclear antigen with a molecular mass of 53 kDa-like 1 isoform X2" /protein_id="XP_026693768.1" /db_xref="GeneID:494417" /translation="
MPARLKWTDEYMKENYGDLRVKLESKYEKDFKPEGDRGMGQDSMRRFLDTYIEHDKYMVSQLPDPLSEEVTVPQPILCGSFRERILEANIWMSSGNTKSLLHRDADNAFNCLLNGTKDWILIDPVHQDLLPVAVESGSPYGGYTLINVNKVDLIEFPEFKEVPWYYANVSAGDCLFLPKGHWHQVRSYGAKNLAVSILFSRLNDFNPKGCPKEGVPPSELLSEVPMVWTYDGFEAQTMGNADPFELKDELEMKCKHAEGKLTLEMFEEDMISGLDVEEEAYKGTLKVDADEYEIPDENIEIMKQRAKAIMDLIDPDNIGYYDCSQLEDMTVDTLKKISDIKDPDPANTDQYEFLHLHPNLVRKTILSSLELSKESFMEKYHSHEGSMAGAQWIFETLDSDNDGRCTVAEVKGNMEKVLERFQDSLLADVTAHQAKKINQNSKDEL"
misc_feature 106..717 /gene="mina53-like1" /note="Cupin-like domain; Region: Cupin_8; pfam13621" /db_xref="CDD:463936" misc_feature 1000..1335 /gene="mina53-like1" /note="Ca2+-binding protein, EF-hand superfamily [Signal transduction mechanisms]; Region: FRQ1; COG5126" /db_xref="CDD:444056" ORIGIN
attgttcatatacgaacggctgaagttcccaccccacaaaagttctgggaggattattgtagtttgggcaaaccagtcttgttgaagggaattgcattggatatgcctgcaaggctgaaatggacagatgaatacatgaaagaaaactatggggatttgagggtgaaacttgaaagcaaatatgaaaaagacttcaaacctgagggtgaccgtggtatgggtcaagactccatgcgacgattccttgacacctatattgagcatgacaagtacatggtgtcacagttacctgacccactctcagaagaagtaacagtcccccaaccaatcttatgtggttcattccgggaaagaattctggaagcaaatatttggatgagttcaggaaacacaaagagtttgttgcacagagatgcagacaatgcattcaattgtcttttgaacggaacaaaagattggattctgattgaccctgtgcatcaggaccttctgcctgttgctgtagaaagtggttcaccatatggcgggtacacactaatcaatgtgaacaaagttgatttgatagaatttccggaattcaaagaagtaccgtggtattacgcgaatgtatctgcaggagattgtctgtttcttcctaaaggacattggcaccaggttcgatcctacggagcgaaaaacttggctgtgagcatcttgttttcgcgcttgaatgattttaatcccaaaggctgccccaaggagggagttcctccttcagagttgttaagtgaggtaccgatggtgtggacatacgacgggtttgaggctcaaactatgggaaatgcagatccatttgagttaaaagatgagcttgagatgaagtgcaaacatgcagaggggaaactaacacttgagatgttcgaggaagacatgatatctgggttggatgtggaggaagaagcttacaaaggaacactcaaggtggatgcagatgaatacgagattcctgatgaaaatatcgagattatgaagcaaagagctaaagcgatcatggacctcattgatcctgataatattggatattatgattgtagtcaacttgaggatatgacagtagacacactgaagaaaatatcggatataaaagatcccgatcctgctaataccgatcaatatgaattcttacatcttcatcccaatcttgttaggaaaactattctgagttctcttgaattatcgaaagaaagtttcatggagaaatatcattcacacgagggttcgatggccggggctcaatggatctttgagactttggattcggacaatgacggtcgatgcacagtggctgaagtaaagggaaatatggagaaggttttggaaagattccaagacagtttgcttgcagatgttacagcccaccaagctaagaagatcaatcaaaattccaaggatgaattatgatcacgttatatttgatgccataagagatttgccacgatgagattattttatttgtaaaatccacttttgatcgtctgttcaatcggtatcttgtgcaatttgtacaataataaaagaaaaagaaatagtttta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]