GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-19 06:31:51, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XM_009860473            1117 bp    mRNA    linear   INV 22-OCT-2018
DEFINITION  PREDICTED: Ciona intestinalis nuclear factor
            interleukin-3-regulated protein-like (LOC104265765), transcript
            variant X1, mRNA.
ACCESSION   XM_009860473
VERSION     XM_009860473.3
DBLINK      BioProject: PRJNA187185
KEYWORDS    RefSeq.
SOURCE      Ciona intestinalis (vase tunicate)
  ORGANISM  Ciona intestinalis
            Eukaryota; Metazoa; Chordata; Tunicata; Ascidiacea; Phlebobranchia;
            Cionidae; Ciona.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_020170.2) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Oct 22, 2018 this sequence version replaced XM_009860473.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Ciona intestinalis Annotation
                                           Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1117
                     /organism="Ciona intestinalis"
                     /mol_type="mRNA"
                     /db_xref="taxon:7719"
                     /chromosome="5"
     gene            1..1117
                     /gene="LOC104265765"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 EST, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     159 samples with support for all annotated introns"
                     /db_xref="GeneID:104265765"
     CDS             22..1059
                     /gene="LOC104265765"
                     /codon_start=1
                     /product="nuclear factor interleukin-3-regulated
                     protein-like isoform X1"
                     /protein_id="XP_009858775.1"
                     /db_xref="GeneID:104265765"
                     /translation="
MNNNNLNNDDFPFVNNNRRSVGPPKLIPIGYLPNPTSFGSFPRFPNPLATNERQNHRQMQLPVRASTGSRRSRHFVPNECKDEYYWRKRKKNNEAARKSREKRKTIDSVLEDKVLFLSQENLCLRNELYALKVKYGEIDGTEAGANNLLSDKDHTDDLSMYSMLPSPSNSLSEVECKSSSNMCQRESTTPPVIYPEGPNEKDELAMHNLHKISELHTKTADGKFKDDDFEPTREVICQTREPHSILSNLAAGKFVLTSIDLPEKSPTQGVDLTIKSAARDSQAIAQNSVPGSDCVTYEAASVLVDLLKMSQNPQTPEKKLEDESGSKYNSSLPHKLRFKGRNLDV"
     misc_feature    262..429
                     /gene="LOC104265765"
                     /note="Basic leucine zipper (bZIP) domain of bZIP
                     transcription factors: a DNA-binding and dimerization
                     domain; Region: bZIP; cl21462"
                     /db_xref="CDD:473870"
     misc_feature    274..429
                     /gene="LOC104265765"
                     /note="coiled coil [structural motif]; Region: coiled
                     coil"
                     /db_xref="CDD:269842"
     misc_feature    order(283..288,292..300,304..321,325..333)
                     /gene="LOC104265765"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:269842"
     misc_feature    order(328..330,337..342,349..354,358..363,370..375,
                     379..384,391..396,400..405,412..417,421..426)
                     /gene="LOC104265765"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:269842"
ORIGIN      
agataattgttgttaaataatatgaataataacaacttaaataatgatgactttcctttcgtaaataacaatcgcagaagtgttggcccacccaagcttataccaattggatatcttcctaatccaacgtcatttggttcttttccacgatttccaaatccattagccacaaatgaacgacaaaaccatagacaaatgcaattgccagtacgggcaagcacggggagtcgcagaagtcgacattttgttccaaacgaatgcaaagatgaatattactggaggaaacgaaagaagaataacgaagcagcaagaaagtcccgagaaaagagaaaaacaattgattctgtgttagaagacaaggtcctatttctaagccaagaaaacttatgtttaagaaatgaattgtacgctttgaaggttaaatatggagaaattgatggaacagaggcaggtgcaaataatcttttgtcagacaaagaccacacagatgatctatctatgtattccatgctcccatccccatctaacagcctcagtgaagtagaatgcaaaagttcttcaaacatgtgtcaacgagaatccacaacaccaccagtcatttacccagaggggcccaacgaaaaggatgaattagcgatgcataatttgcacaaaatctcagagcttcacaccaaaacagcagatggcaaatttaaagatgatgattttgaacccacgcgtgaagtaatctgccaaacaagggaacctcattctattctatcaaacttagctgctggcaagtttgtcctcacgtcaattgatttacctgaaaaaagtccaactcaaggggttgatttgacaataaaatctgctgcaagagactctcaagctatagctcaaaactctgttccaggctcagactgtgtgacttatgaagctgcgagcgttctggttgacctgttaaaaatgtcgcagaatccacaaacgccagagaaaaaactagaggatgaaagtggcagcaaatataattctagtcttccccacaagttgcgatttaagggaagaaacttagatgtttaggatttggtggctataaggaattacacgcacactatacacagtaatcttcacatggctg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]