2024-07-04 06:14:39, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS XM_004226774 776 bp mRNA linear INV 22-OCT-2018 DEFINITION PREDICTED: Ciona intestinalis 40S ribosomal protein S5 (LOC100186730), transcript variant X1, mRNA. ACCESSION XM_004226774 VERSION XM_004226774.3 DBLINK BioProject: PRJNA187185 KEYWORDS RefSeq. SOURCE Ciona intestinalis (vase tunicate) ORGANISM Ciona intestinalis Eukaryota; Metazoa; Chordata; Tunicata; Ascidiacea; Phlebobranchia; Cionidae; Ciona. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_020178.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Oct 22, 2018 this sequence version replaced XM_004226774.2. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Ciona intestinalis Annotation Release 104 Annotation Version :: 104 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..776 /organism="Ciona intestinalis" /mol_type="mRNA" /db_xref="taxon:7719" /chromosome="13" gene 1..776 /gene="LOC100186730" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 mRNA, 1277 ESTs, 35 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 227 samples with support for all annotated introns" /db_xref="GeneID:100186730" CDS 124..738 /gene="LOC100186730" /codon_start=1 /product="40S ribosomal protein S5" /protein_id="XP_004226822.1" /db_xref="GeneID:100186730" /translation="
MEEDYEADVIVAEAPEVKLFGRWTTSDVQINDISLTDYLPVKDKYSKYLPHSSGRYQIKRFRKAQCPIVERLVNSMMMHGRNTGKKLLTVRIIKHAFEIIHLLTGENPLQVLVNAIINSGPREDSTRIGRAGTVRRQSVDVSPLRRVNQAIWLLCTGAREASFRNIKTIAECLADELINAHKGSSNSYAIKKKDELERVAKSNR"
misc_feature 175..735 /gene="LOC100186730" /note="Eukaryota homolog of Ribosomal Protein S7; Region: uS7_Eukaryote; cd14867" /db_xref="CDD:271246" misc_feature order(175..177,262..270,274..285,382..384,394..396) /gene="LOC100186730" /note="S9 interface [polypeptide binding]; other site" /db_xref="CDD:271246" misc_feature order(274..276,280..282,292..303,310..312,334..336, 343..345,349..363,373..387,394..396,514..522,526..528, 556..558,577..579,598..600,607..609,625..630) /gene="LOC100186730" /note="rRNA binding site [nucleotide binding]; other site" /db_xref="CDD:271246" misc_feature order(406..408,415..420,427..429,625..627,631..636) /gene="LOC100186730" /note="S25 interface [polypeptide binding]; other site" /db_xref="CDD:271246" misc_feature order(511..513,520..522,526..528,733..735) /gene="LOC100186730" /note="S11 interface [polypeptide binding]; other site" /db_xref="CDD:271246" ORIGIN
tttatttaaccatactactcccctatgagatttaccatttagcgccggcagtggtggaaaatcgcgtgtagtttctcttttttaagtcgtcatttcccttttcagaaaagtcgccacgaaaatatggaggaagactacgaagcagacgttatcgtagctgaagcacccgaggtgaaattgttcggacgatggacaacaagtgatgttcagatcaatgacatctcactcacggactacttacccgtgaaggacaaatactccaagtatcttcctcacagctccggtcgttaccagatcaaacgcttccgtaaagcacaatgtcccattgtggagcgcttggttaactccatgatgatgcatggacgaaacactggcaagaaactgctgactgttcgaatcatcaaacatgcgtttgagatcatccatcttttgactggtgaaaatccacttcaagttttggtgaatgctattatcaacagtggtccacgtgaagattccactcgtattggtcgtgcgggtacagtaagaagacagtctgtggacgtatcaccattacgtcgagtcaaccaagctatctggttattgtgcaccggtgcacgcgaggcttctttccgtaacattaagacgattgctgagtgtttggctgatgaactcattaacgctcataagggctcatctaactcgtatgccatcaagaagaaggatgaacttgagagagtcgcaaaatccaaccgttaaaatgcatcggcaataatggaaataaaatctcaaaccaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]