2025-07-16 04:10:38, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_069816 3268 bp mRNA linear INV 04-DEC-2024 DEFINITION Caenorhabditis elegans Argonaute (plant)-Like Gene (alg-3), mRNA. ACCESSION NM_069816 VERSION NM_069816.3 DBLINK BioProject: PRJNA158 KEYWORDS RefSeq. SOURCE Caenorhabditis elegans ORGANISM Caenorhabditis elegans Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis. REFERENCE 1 (bases 1 to 3268) AUTHORS Sulson,J.E. and Waterston,R. CONSRTM Caenorhabditis elegans Sequencing Consortium TITLE Genome sequence of the nematode C. elegans: a platform for investigating biology JOURNAL Science 282 (5396), 2012-2018 (1998) PUBMED 9851916 REMARK Erratum:[Science 1999 Jan 1;283(5398):35] REFERENCE 2 (bases 1 to 3268) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (04-DEC-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 3268) AUTHORS WormBase. CONSRTM WormBase Consortium TITLE Direct Submission JOURNAL Submitted (17-OCT-2024) WormBase Group, European Bioinformatics Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org REFERENCE 4 (bases 1 to 3268) AUTHORS Sulson,J.E. and Waterston,R. TITLE Direct Submission JOURNAL Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute at Washington University, St. Louis, MO 63110, USA COMMENT REVIEWED REFSEQ: This record has been curated by WormBase. This record is derived from an annotated genomic sequence (NC_003282). On Apr 15, 2020 this sequence version replaced NM_069816.2. FEATURES Location/Qualifiers source 1..3268 /organism="Caenorhabditis elegans" /mol_type="mRNA" /strain="Bristol N2" /db_xref="taxon:6239" /chromosome="IV" gene 1..3268 /gene="alg-3" /locus_tag="CELE_T22B3.2" /db_xref="GeneID:178106" /db_xref="WormBase:WBGene00011910" CDS 71..3178 /gene="alg-3" /locus_tag="CELE_T22B3.2" /standard_name="T22B3.2b" /note="Product from WormBase gene class alg; Confirmed by transcript evidence" /codon_start=1 /product="Argonaute (plant)-Like Gene" /protein_id="NP_502217.1" /db_xref="GeneID:178106" /db_xref="WormBase:WBGene00011910" /translation="
MSRRNATNFVDNNTLTSSGISGSGSLSPPITSRPASGQASPLSSNGSLSPPVDDQGSVSYNSDSPRDLSPLLLSELACLNMREVVARPGLGTIGRKIPVKSNFFAVDLKNPKMVVVQYHVEVHHPGCRKLDKDEMRIIFWKAVSDHPNIFHNKFALAYDGAHQLYTVARLEFPDDQGSVRLDCEATLPKDNRDRTRCAISIQNVGPVLLEMQRTRTNNLDERVLTPIQILDIICRQSLTCPLLKNSANFYTWKSSCYRIPTAAGQALDLEGGKEMWTGFFSSAHIASNYRPLLNIDVAHTAFYKTRITVLQFMCDVLNERTSKPNRNNPRGPGAPGGYRGGRGGARGGSYQNFGNRGPPGANVRDDFGGNGLTFTMDTLSRDTQLSSFETRIFGDSIRGMKIRATHRPNAIRVYKVNSLQLPADKLMFQGIDEEGRQVVCSVADYFSEKYGPLKYPKLPCLHVGPPTRNIFLPMEHCLIDSPQKYNKKMTEKQTSAIIKAAAVDATQREDRIKQLAAQASFGTDPFLKEFGVAVSSQMIETSARVIQPPPIMFGGNNRSINPVVFPKDGSWSMDHQTLYMPATCRSYSMIALVDPRDQTSLQTFCQSLTMKATAMGMNFPRWPDLVKYGRSKEDVCTLFTEIADEYRVTNTVCDCIIVVLQSKNSDIYMTVKEQSDIVHGIMSQCVLMKNVSRPTPATCANIILKLNMKMGGINSRIVADQITNKYLVDQPTMVVGIDVTHPTQAEMRMNMPSVAAIVANVDLLPQSYGANVKVQKKCRESVVYLLDAIRERIITFYRHTKQKPARIIVYRDGVSEGQFSEVLREEIQSIRTACLAIAEDFRPPITYIVVQKRHHARIFCKFPNDMVGKAKNVPPGTTVDTGIVSPEGFDFYLCSHYGVQGTSRPARYHVLLDECKFTADEIQNITYGMCHTYGRCTRSVSIPTPVYYADLVATRARCHIKRKLGLADNNDCDTNSLSSSLASLLNVRTGSGKGKKSHAPSVDDESYSLPDAASDQILQDCVSVAADFKSRMYFI"
misc_feature 524..769 /gene="alg-3" /locus_tag="CELE_T22B3.2" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:465134" misc_feature 848..982 /gene="alg-3" /locus_tag="CELE_T22B3.2" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:462567" misc_feature 1175..1507 /gene="alg-3" /locus_tag="CELE_T22B3.2" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(1310..1312,1352..1354,1394..1396,1406..1408, 1457..1459,1478..1480,1484..1486) /gene="alg-3" /locus_tag="CELE_T22B3.2" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1643..2950 /gene="alg-3" /locus_tag="CELE_T22B3.2" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(2072..2074,2084..2086,2120..2131,2138..2140, 2162..2164,2171..2173,2183..2185,2195..2197) /gene="alg-3" /locus_tag="CELE_T22B3.2" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(2282..2284,2288..2290,2504..2506,2918..2920) /gene="alg-3" /locus_tag="CELE_T22B3.2" /note="active site" /db_xref="CDD:240015" ORIGIN
aattcagtttgtgatttttcttttccggaaaacgctctacaaaagtacgagctctcttaaagaatctgaaatgtcaagaaggaatgcgacaaattttgtggataacaacacgctgactagttcagggatctcaggatctggttcactgtcaccaccaataacatctcgtccagcgtcaggacaagcgtcaccactctcatccaatggatctttatcacctcctgtcgatgatcaaggttctgtgtcttacaattctgactcgccacgtgacttgagccctcttcttttatcggaattggcctgtctcaacatgcgcgaggtggttgccagaccaggacttggaactatcggacgaaagattccagtgaaatctaacttctttgccgtcgacctgaagaatccgaaaatggttgtagttcagtatcacgttgaagttcatcatccaggatgtagaaaattggacaaagacgaaatgcgtatcattttttggaaagctgtgtcagatcatcctaacatcttccacaataagtttgcattggcatatgatggagctcaccagctatatactgtcgctcgtctcgaattcccggatgatcaaggatctgttcgtcttgactgtgaagctactcttccgaaggataaccgtgatcgtactcgatgtgcaatttcgattcagaatgttgggcctgttttgcttgagatgcaacgtactcgtaccaataatttggatgagcgtgtcctcactccgatccagattttggatattatttgccgccaatcattgacctgtccacttctcaagaattctgccaatttctacacctggaaatcgtcttgctaccgtattccaacggctgccggacaagctcttgatttggaaggaggaaaagaaatgtggactggtttcttctcaagtgcccacattgcgagcaactaccgtcctcttctgaacattgatgtggcacatacggcattctacaagacacgtattactgttcttcagtttatgtgtgacgttttgaatgaaagaacatcaaagccgaatcgcaacaatccacgtggaccgggagcaccgggaggatatcgtggtggacgaggtggtgcaagaggaggcagctaccagaactttggtaatcgtggaccgcctggagctaacgttcgtgacgactttggtggaaatggtcttactttcacaatggatacgttgagccgtgatacccaattgtcgagctttgagactcgtatctttggagattcgattcgtggaatgaagattcgtgccactcatcgcccaaatgcaattcgtgtctacaaagtgaacagtcttcaattgccagctgacaagttgatgttccaaggaatcgatgaggaaggacgacaagttgtgtgctcggttgctgactacttctccgagaagtacggaccactcaagtatccaaaacttccatgtctccatgtcggaccacccactcgtaacatcttcctgccaatggaacattgtttgattgattctcctcaaaagtacaacaaaaagatgactgaaaaacagaccagtgccatcatcaaggctgcagctgttgacgctactcaacgggaagatcggatcaagcaattggctgctcaagcatcgtttggtactgatcctttcctcaaagaattcggagtagcagtctcttctcaaatgattgaaacaagtgctcgtgtcatccagccaccaccaatcatgttcggaggaaataatcgttcaattaatccagtggtgttcccgaaggacggatcatggtctatggatcatcagacactttacatgcctgccacttgtcgcagttactcaatgattgctcttgtggatccacgtgatcagacatcgctccagacattctgccaatctttaacaatgaaggctaccgcaatgggaatgaatttcccgcgttggccggatctggtgaagtacggtagatcaaaggaagatgtttgcactctcttcactgagattgctgatgaatatcgtgtgactaatacagtttgtgattgcatcattgtagttctccagtccaaaaactcggacatctacatgactgtgaaggaacaatctgacattgttcacggaattatgtcccaatgcgtgctcatgaagaatgtgagccgtccaactccagcgacttgtgccaacattattctcaagctcaacatgaaaatgggaggaatcaatagtcgtattgttgctgatcaaatcactaacaaatatcttgttgatcaaccgaccatggttgttggaattgacgttactcatccaactcaagctgaaatgcgtatgaatatgccatcagttgcagctatcgttgcaaacgttgacttgcttccacaatcgtatggtgcaaatgtgaaggtgcagaagaaatgtcgtgaatcggttgtctacttgctggatgcaattcgtgagagaatcattactttctacagacataccaagcaaaagccagctcgtatcattgtctatcgtgatggagtgtctgaaggacaattctctgaagttctccgcgaagagattcaatcaatccgtacggcttgcctggcaattgctgaagacttccgtccaccaataacctacatcgttgttcaaaaaagacatcatgctcgcatcttctgcaagttcccgaacgacatggttggaaaggcaaagaatgttccacctggtaccactgtcgacactggaatcgtctctcccgaaggatttgatttctacctatgctctcactatggagtacagggaacttctcgccctgcgagatatcacgttcttctggatgaatgcaagttcactgctgatgaaattcaaaacatcacttatggaatgtgccatacatatggtcgttgtactcgttcggtctccatcccaactccagtttactatgctgatttggttgctactcgtgcccgctgtcacatcaagagaaagctcggtcttgccgacaacaatgactgtgacaccaactcgctctcttcatcacttgcttctttgctcaacgtgagaactggaagtggaaaaggaaagaagtcacatgctccaagcgtcgatgatgaatcgtattctcttcctgacgctgcatctgatcaaatccttcaggactgcgtctcggttgcagctgactttaagagtcgtatgtacttcatttgaagactcttcatgcagacggagccagagaaaattgttcatttctttaaacttgatgtcctttttgtatcgccaaaataaagtttcggacat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]