2024-09-28 09:26:34, GGRNA.v2 : RefSeq release 225 (Jul, 2024)
LOCUS NM_063883 747 bp mRNA linear INV 11-JUN-2024 DEFINITION Caenorhabditis elegans Exosome complex component RRP46 homolog (crn-5), mRNA. ACCESSION NM_063883 VERSION NM_063883.4 DBLINK BioProject: PRJNA158 KEYWORDS RefSeq. SOURCE Caenorhabditis elegans ORGANISM Caenorhabditis elegans Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis. REFERENCE 1 (bases 1 to 747) AUTHORS Sulson,J.E. and Waterston,R. CONSRTM Caenorhabditis elegans Sequencing Consortium TITLE Genome sequence of the nematode C. elegans: a platform for investigating biology JOURNAL Science 282 (5396), 2012-2018 (1998) PUBMED 9851916 REMARK Erratum:[Science 1999 Jan 1;283(5398):35] REFERENCE 2 (bases 1 to 747) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (11-JUN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 747) AUTHORS WormBase. CONSRTM WormBase Consortium TITLE Direct Submission JOURNAL Submitted (23-MAY-2024) WormBase Group, European Bioinformatics Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org REFERENCE 4 (bases 1 to 747) AUTHORS Sulson,J.E. and Waterston,R. TITLE Direct Submission JOURNAL Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute at Washington University, St. Louis, MO 63110, USA COMMENT REVIEWED REFSEQ: This record has been curated by WormBase. This record is derived from an annotated genomic sequence (NC_003280). On Sep 4, 2019 this sequence version replaced NM_063883.3. FEATURES Location/Qualifiers source 1..747 /organism="Caenorhabditis elegans" /mol_type="mRNA" /strain="Bristol N2" /db_xref="taxon:6239" /chromosome="II" gene 1..747 /gene="crn-5" /locus_tag="CELE_C14A4.5" /db_xref="GeneID:174634" CDS 11..655 /gene="crn-5" /locus_tag="CELE_C14A4.5" /standard_name="C14A4.5" /note="Confirmed by transcript evidence" /codon_start=1 /product="Exosome complex component RRP46 homolog" /protein_id="NP_496284.1" /db_xref="GeneID:174634" /translation="
MAGRLREMRCELSFLKNADGSACFSQGATCIWASCSGPGDVHASKASDEAMTLDISYRANCGDNKFNVLNNIIHSTLSNAINLELFPHTTISVTVHGIQDDGSMGAVAINGACFALLDNGMPFETVFCGVLIVRVKDELIIDPTAKQEAASTGRVLFSVCKGSDGHPEVCAMDAIGHWDFIQLEAAWSLAQPSASAIFDFYKTVMKRKLSVDEQ"
misc_feature 23..616 /gene="crn-5" /locus_tag="CELE_C14A4.5" /note="RRP46 subunit of eukaryotic exosome; Region: RNase_PH_RRP46; cd11372" /db_xref="CDD:206777" misc_feature order(47..49,53..58,62..67,122..130,266..268,272..274, 368..370,374..382,386..388,494..496,614..616) /gene="crn-5" /locus_tag="CELE_C14A4.5" /note="Rrp40 interface [polypeptide binding]; other site" /db_xref="CDD:206777" misc_feature order(59..61,65..67,110..112,116..124,170..172,176..178, 191..193,212..214,221..223,233..235,275..277,290..292, 305..307,359..367,515..550,557..559,569..571) /gene="crn-5" /locus_tag="CELE_C14A4.5" /note="hexamer interface [polypeptide binding]; other site" /db_xref="CDD:206777" ORIGIN
atatccccaaatggccggcagacttcgtgaaatgcgttgtgagctctcgttcctcaaaaacgcggatggctcggcatgcttctcccagggtgccacgtgtatttgggcttcatgcagtggtcctggagatgttcacgcttcgaaagcaagtgatgaggctatgactctggatattagttatagagcaaattgtggagataacaagttcaatgtgctgaacaatatcattcattctactctatccaatgcaatcaatctcgaattgtttccccacacaacaatttctgtcacagtacatggaattcaggatgatggaagtatgggagctgtagcgataaatggagcttgttttgctctacttgacaatggaatgccattcgaaacagtcttctgtggtgtccttattgttcgtgtcaaagatgagctgattattgatccgacagcaaaacaagaagctgcatcgactggaagagtgctcttttcagtgtgcaaaggatccgatggacatccagaagtgtgtgcgatggacgctataggacattgggattttattcagctggaagccgcgtggtcattggcacaaccatctgccagtgctatttttgatttctacaaaactgtgatgaagaggaagctttcggttgatgagcaatagattatcaatgttttgttgttgtcgttgttgattttaattttttatttaattttgaatccattgttttgtgagatattaaaatcttaaatttc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]