GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-09-28 09:26:34, GGRNA.v2 : RefSeq release 225 (Jul, 2024)

LOCUS       NM_063883                747 bp    mRNA    linear   INV 11-JUN-2024
DEFINITION  Caenorhabditis elegans Exosome complex component RRP46 homolog
            (crn-5), mRNA.
ACCESSION   NM_063883
VERSION     NM_063883.4
DBLINK      BioProject: PRJNA158
KEYWORDS    RefSeq.
SOURCE      Caenorhabditis elegans
  ORGANISM  Caenorhabditis elegans
            Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida;
            Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae;
            Caenorhabditis.
REFERENCE   1  (bases 1 to 747)
  AUTHORS   Sulson,J.E. and Waterston,R.
  CONSRTM   Caenorhabditis elegans Sequencing Consortium
  TITLE     Genome sequence of the nematode C. elegans: a platform for
            investigating biology
  JOURNAL   Science 282 (5396), 2012-2018 (1998)
   PUBMED   9851916
  REMARK    Erratum:[Science 1999 Jan 1;283(5398):35]
REFERENCE   2  (bases 1 to 747)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (11-JUN-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 747)
  AUTHORS   WormBase.
  CONSRTM   WormBase Consortium
  TITLE     Direct Submission
  JOURNAL   Submitted (23-MAY-2024) WormBase Group, European Bioinformatics
            Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org
REFERENCE   4  (bases 1 to 747)
  AUTHORS   Sulson,J.E. and Waterston,R.
  TITLE     Direct Submission
  JOURNAL   Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger
            Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute
            at Washington University, St. Louis, MO 63110, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by WormBase. This
            record is derived from an annotated genomic sequence (NC_003280).
            
            On Sep 4, 2019 this sequence version replaced NM_063883.3.
FEATURES             Location/Qualifiers
     source          1..747
                     /organism="Caenorhabditis elegans"
                     /mol_type="mRNA"
                     /strain="Bristol N2"
                     /db_xref="taxon:6239"
                     /chromosome="II"
     gene            1..747
                     /gene="crn-5"
                     /locus_tag="CELE_C14A4.5"
                     /db_xref="GeneID:174634"
     CDS             11..655
                     /gene="crn-5"
                     /locus_tag="CELE_C14A4.5"
                     /standard_name="C14A4.5"
                     /note="Confirmed by transcript evidence"
                     /codon_start=1
                     /product="Exosome complex component RRP46 homolog"
                     /protein_id="NP_496284.1"
                     /db_xref="GeneID:174634"
                     /translation="
MAGRLREMRCELSFLKNADGSACFSQGATCIWASCSGPGDVHASKASDEAMTLDISYRANCGDNKFNVLNNIIHSTLSNAINLELFPHTTISVTVHGIQDDGSMGAVAINGACFALLDNGMPFETVFCGVLIVRVKDELIIDPTAKQEAASTGRVLFSVCKGSDGHPEVCAMDAIGHWDFIQLEAAWSLAQPSASAIFDFYKTVMKRKLSVDEQ"
     misc_feature    23..616
                     /gene="crn-5"
                     /locus_tag="CELE_C14A4.5"
                     /note="RRP46 subunit of eukaryotic exosome; Region:
                     RNase_PH_RRP46; cd11372"
                     /db_xref="CDD:206777"
     misc_feature    order(47..49,53..58,62..67,122..130,266..268,272..274,
                     368..370,374..382,386..388,494..496,614..616)
                     /gene="crn-5"
                     /locus_tag="CELE_C14A4.5"
                     /note="Rrp40 interface [polypeptide binding]; other site"
                     /db_xref="CDD:206777"
     misc_feature    order(59..61,65..67,110..112,116..124,170..172,176..178,
                     191..193,212..214,221..223,233..235,275..277,290..292,
                     305..307,359..367,515..550,557..559,569..571)
                     /gene="crn-5"
                     /locus_tag="CELE_C14A4.5"
                     /note="hexamer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:206777"
ORIGIN      
atatccccaaatggccggcagacttcgtgaaatgcgttgtgagctctcgttcctcaaaaacgcggatggctcggcatgcttctcccagggtgccacgtgtatttgggcttcatgcagtggtcctggagatgttcacgcttcgaaagcaagtgatgaggctatgactctggatattagttatagagcaaattgtggagataacaagttcaatgtgctgaacaatatcattcattctactctatccaatgcaatcaatctcgaattgtttccccacacaacaatttctgtcacagtacatggaattcaggatgatggaagtatgggagctgtagcgataaatggagcttgttttgctctacttgacaatggaatgccattcgaaacagtcttctgtggtgtccttattgttcgtgtcaaagatgagctgattattgatccgacagcaaaacaagaagctgcatcgactggaagagtgctcttttcagtgtgcaaaggatccgatggacatccagaagtgtgtgcgatggacgctataggacattgggattttattcagctggaagccgcgtggtcattggcacaaccatctgccagtgctatttttgatttctacaaaactgtgatgaagaggaagctttcggttgatgagcaatagattatcaatgttttgttgttgtcgttgttgattttaattttttatttaattttgaatccattgttttgtgagatattaaaatcttaaatttc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]