2024-07-02 00:44:25, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS NM_062750 2739 bp mRNA linear INV 22-NOV-2023 DEFINITION Caenorhabditis elegans Piwi-like protein (wago-5), partial mRNA. ACCESSION NM_062750 VERSION NM_062750.3 DBLINK BioProject: PRJNA158 KEYWORDS RefSeq. SOURCE Caenorhabditis elegans ORGANISM Caenorhabditis elegans Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis. REFERENCE 1 (bases 1 to 2739) AUTHORS Sulson,J.E. and Waterston,R. CONSRTM Caenorhabditis elegans Sequencing Consortium TITLE Genome sequence of the nematode C. elegans: a platform for investigating biology JOURNAL Science 282 (5396), 2012-2018 (1998) PUBMED 9851916 REMARK Erratum:[Science 1999 Jan 1;283(5398):35] REFERENCE 2 (bases 1 to 2739) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (22-NOV-2023) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 2739) AUTHORS WormBase. CONSRTM WormBase Consortium TITLE Direct Submission JOURNAL Submitted (29-OCT-2023) WormBase Group, European Bioinformatics Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org REFERENCE 4 (bases 1 to 2739) AUTHORS Sulson,J.E. and Waterston,R. TITLE Direct Submission JOURNAL Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute at Washington University, St. Louis, MO 63110, USA COMMENT REVIEWED REFSEQ: This record has been curated by WormBase. This record is derived from an annotated genomic sequence (NC_003280). On Feb 27, 2013 this sequence version replaced NM_062750.2. COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..2739 /organism="Caenorhabditis elegans" /mol_type="mRNA" /strain="Bristol N2" /db_xref="taxon:6239" /chromosome="II" gene <1..>2739 /gene="wago-5" /locus_tag="CELE_ZK1248.7" /db_xref="GeneID:191545" /db_xref="WormBase:WBGene00022877" CDS 1..2739 /gene="wago-5" /locus_tag="CELE_ZK1248.7" /standard_name="ZK1248.7" /note="Partially confirmed by transcript evidence" /codon_start=1 /product="Piwi-like protein" /protein_id="NP_495151.3" /db_xref="EnsemblGenomes-Gn:WBGene00022877" /db_xref="EnsemblGenomes-Tr:ZK1248.7" /db_xref="GeneID:191545" /db_xref="GOA:D9N120" /db_xref="InterPro:IPR003100" /db_xref="InterPro:IPR003165" /db_xref="InterPro:IPR012337" /db_xref="InterPro:IPR036085" /db_xref="InterPro:IPR036397" /db_xref="UniProtKB/TrEMBL:D9N120" /db_xref="WormBase:WBGene00022877" /translation="
MNTGVVLLDQNDQKLYQTTANDACINRLKELNVESGAKIYTTPTEPGTLGKQVDVGTNIFGVEVTKETTVHRFVVHAKADLTSTKEVTFTKKGKEDFVVLDRREKCCNLFFNAVEKNPDFFKMKDGNHIVYDGQSTLYTTINLFSELDCNQTKSKVFQINGADTGNDELKTLPCISLEIHAPRDNSITISAKILGERTADQNIEVNNREYTQFLELALNQHCTRETKRFGCFEHGKVYFLNATEEGFDQRDCVDVGDGKALYPGLKKTIQFIEGPFGRGQNNPSLVIDGMKAAFHKEQTVIQKLFEITGQDPSNGLSSMAREKATPVIKGLDCYSMYTSRKRHLRIVGIFHESATGTRFELPDGKTCSIAEYFRDKYSINLQYPKANLVVCKDRGNNNYFPAELMTISKNQRATIPQQTQSQKTTKECAVLPDVRQRIIIKGKTAVNITAENELLNALGIKVYSEPLKVSLKELGYQRSTVKSELGKWRPPPGSFVKPAAFQDLWALYAVGNQNSRFSVSDLSQFTGMFIDACKKRGMIIKPPSETSLCHMDNIISLLENAAASKCKFAFVITDDSITHLHKKYKALEQKSMMVIQDMKISKANSVVKDGKRLTLENVINKTNMKLGGLNYTVSDAKKSMTDEQLIIGVGVSAPPAGTKYMMDNKGHLNPQIIGFASNAVANHEFVGDFVLAPSGQDTMASIEDVLKSSIDLFEMNRNTLPKRIIIYRSGASDGSHASILAYEIPLARATIQGYSKDINLIYIIVTKEHSYRFFRDQLRSGGKATEMNIPPGIVLDSAVTNPACKQFFLNGHTTLQGTAKTPLYTILADDCNAPMDRLEELTYTLCHHHQIVALSTSIPTPLYVANEYAKRGRDLWAHGPNEANEYHEEHLKELSKQLGYKNTVFNKTRINA"
misc_feature 889..1221 /gene="wago-5" /locus_tag="CELE_ZK1248.7" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(1030..1032,1075..1077,1105..1107,1117..1119, 1171..1173,1192..1194,1198..1200) /gene="wago-5" /locus_tag="CELE_ZK1248.7" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1702..2628 /gene="wago-5" /locus_tag="CELE_ZK1248.7" /note="This domain is found in the protein Piwi and its relatives; Region: Piwi; smart00950" /db_xref="CDD:214930" misc_feature order(1741..1743,1753..1755,1786..1797,1804..1806, 1840..1842,1849..1851,1861..1863,1873..1875) /gene="wago-5" /locus_tag="CELE_ZK1248.7" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:239208" misc_feature order(1948..1950,1954..1956,2185..2187,2596..2598) /gene="wago-5" /locus_tag="CELE_ZK1248.7" /note="active site" /db_xref="CDD:239208" ORIGIN
atgaatactggcgttgtcctgttggatcaaaatgatcaaaagctctaccaaacgactgccaatgatgcatgcatcaatcgtctgaaagaattgaacgtggaaagtggagctaagatctacactacgccaaccgaaccgggaacattgggtaaacaagtggatgttggaacaaacatcttcggagtggaagttaccaaggaaacaacagttcacagattcgtggttcatgccaaggccgatttgacttccacgaaggaagtgaccttcactaaaaaaggaaaagaggacttcgtagtgttggatcgtcgtgagaaatgctgcaacctgtttttcaatgcagtggagaagaacccagatttcttcaaaatgaaagacgggaatcatatcgtatatgacggccaatccactctctacactacgatcaatttgttctcggaactggattgcaaccagacaaagtctaaagtctttcaaatcaatggagcggacacgggaaacgacgaactcaagacgttgccgtgcatctctcttgagattcatgcaccacgagacaattccatcaccatctctgctaaaatcctgggcgagcgtactgctgatcaaaacattgaagtgaacaatcgtgaatacactcaattcctggaacttgctttgaatcaacattgcacgagggaaacaaagcgtttcggatgtttcgagcatggaaaagtatatttcctcaacgccaccgaggaaggatttgatcagcgagattgtgtcgacgttggcgacggaaaagcgctgtatcctggcctcaagaagacgatccaattcattgaaggtccgttcggtcgtggacagaacaatccatctcttgtgattgatggcatgaaagctgctttccataaagagcaaactgtgatccagaagctctttgagattacgggacaagatccatcaaacgggctcagtagtatggctcgtgagaaggctactccagtgattaaaggactcgattgctattcaatgtacacgagcagaaagcgtcatctgagaatcgtaggaatcttccacgaaagtgccacagggacgagattcgagttgcccgatgggaagacgtgttcaatcgccgagtacttcagggacaaatacagcataaatcttcaatacccgaaagccaatttggtggtttgcaaagatcgaggaaacaacaattacttcccggctgaattgatgaccatctcgaaaaatcagcgtgcaactattcctcagcaaactcagtctcagaagacgacgaaggaatgtgcggttctccctgatgttcgccagagaatcatcatcaagggcaaaactgctgtcaacatcacagcggagaatgagctcctcaacgctcttggaatcaaagtttattcagagcctttgaaggttagtttgaaagaactgggataccagagatcaacggtcaagtctgagttgggaaaatggcgtccaccaccagggtcatttgtgaaacccgctgcttttcaagatttatgggctttgtatgctgttggaaatcaaaattccagattctccgttagtgacctgagccaattcaccggaatgttcattgatgcttgcaagaagagaggaatgataatcaagcctccaagtgaaacatccctttgtcacatggataacataatttccctactggaaaatgcggctgcgagcaaatgcaaatttgccttcgtgatcaccgatgactctatcactcatctccacaagaaatacaaggccctcgaacaaaagtcgatgatggttatacaggatatgaaaatttccaaagccaactctgttgtcaaggatggaaagagattgactctggaaaacgtcatcaacaaaactaacatgaagttgggtggtctcaactacacggtctcggatgcaaagaagagcatgaccgacgaacaattgatcatcggagttggcgtttccgcaccaccggctggaacgaagtacatgatggataacaaaggacatcttaatccacaaattattggcttcgcttcaaatgctgttgcaaaccacgagtttgttggagatttcgttttggccccttcaggacaggatacaatggcatcaattgaagacgttttgaaaagttccatcgatctgtttgagatgaatcgcaatactttgccaaagcggatcatcatttatagaagtggtgcatcggatggctctcatgcgtctattcttgcctacgaaattccactggcacgtgctaccattcagggatactccaaagatatcaatctgatttacatcatcgtcaccaaggagcacagttacagatttttccgtgatcagcttcgttccggcggaaaagcgacagagatgaacatcccaccgggtatcgtcttggatagcgctgtcaccaatcctgcatgcaagcaattcttcctcaatggacacacaactctgcaaggaactgccaagactcctctctacactattctggcagatgactgtaacgctccgatggatcgccttgaggagctcacatacactctttgccatcaccatcaaatcgtggcactgagcacttcaattccgactcctctttatgttgccaacgagtatgcaaaacgtggaagagatctctgggctcatggacctaatgaagcgaatgaataccatgaagagcatctcaaggaactttcaaaacaactcggatacaagaacactgtcttcaacaagactcgcatcaatgcttag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]