2024-09-28 09:24:59, GGRNA.v2 : RefSeq release 225 (Jul, 2024)
LOCUS NM_001356816 20907 bp mRNA linear INV 11-JUN-2024 DEFINITION Caenorhabditis elegans Muscle M-line assembly protein unc-89 (unc-89), partial mRNA. ACCESSION NM_001356816 VERSION NM_001356816.3 DBLINK BioProject: PRJNA158 KEYWORDS RefSeq. SOURCE Caenorhabditis elegans ORGANISM Caenorhabditis elegans Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis. REFERENCE 1 (bases 1 to 20907) AUTHORS Sulson,J.E. and Waterston,R. CONSRTM Caenorhabditis elegans Sequencing Consortium TITLE Genome sequence of the nematode C. elegans: a platform for investigating biology JOURNAL Science 282 (5396), 2012-2018 (1998) PUBMED 9851916 REMARK Erratum:[Science 1999 Jan 1;283(5398):35] REFERENCE 2 (bases 1 to 20907) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (11-JUN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 20907) AUTHORS WormBase. CONSRTM WormBase Consortium TITLE Direct Submission JOURNAL Submitted (23-MAY-2024) WormBase Group, European Bioinformatics Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org REFERENCE 4 (bases 1 to 20907) AUTHORS Sulson,J.E. and Waterston,R. TITLE Direct Submission JOURNAL Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute at Washington University, St. Louis, MO 63110, USA COMMENT REVIEWED REFSEQ: This record has been curated by WormBase. This record is derived from an annotated genomic sequence (NC_003279). On Apr 15, 2020 this sequence version replaced NM_001356816.2. COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..20907 /organism="Caenorhabditis elegans" /mol_type="mRNA" /strain="Bristol N2" /db_xref="taxon:6239" /chromosome="I" gene <1..>20907 /gene="unc-89" /locus_tag="CELE_C09D1.1" /db_xref="GeneID:171990" CDS 1..20907 /gene="unc-89" /locus_tag="CELE_C09D1.1" /standard_name="C09D1.1j" /note="Partially confirmed by transcript evidence" /codon_start=1 /product="Muscle M-line assembly protein unc-89" /protein_id="NP_001343713.1" /db_xref="GeneID:171990" /translation="
MVLKTLYIIELTDTEEGGLELVDPSWCPEEGGPPRKKVKSPPVISPTGSSTSIYSGGSSSIDWTTTGTTLEMQGTRVTRTQYGFRTLQESSAKMCLKVTGYPLPDITWYKDDVQLHEDERHTFYSDEDGFFAMTIDPVQVTDTGRYTCMATNEYGQASTSAFFRVLKVEKEAAPPAFVTKLRDKECKEGDVIDFECEVEGWPEPELVWLVDDQPLRPSHDFRLQYDGQTAKLEIRDAQPDDTGVYTVKIQNEFGSIESKAELFVQADPDKNHVAPEFQATIEYVECDEGEEVRFKSVITGDPNPEIIWFINGKPLSESEKVKFISEDGICILTIKDVTRHFDGMVTCQGSNRLGSASCDGRLKVRVPPAPPTFNKPLEDKTVQEKSTVVFEVDVSGWPEPTLTFTLCGKELKNGEEGVEIVGHDGFYRISIPNTSMDKHDGEIVAKAQNEHGTAESRARLTVEQEEEESRSAPTFLKDIEDQTVKTGEFAVFETTVRGNPNPEVTWFINGHKMDQGSPGVKIEAHNHDHKLTIDSAQYAGTVLCRAENAVGRFETKARLVVLAPEKQKKPPKFVEILVDKTETVDNTVVFEVRVEGEPKPTVTWYLKGEELKQSDRVEIREFDGSIKISIKNIKIEDAGEIRAVATNSEGSDETKAKLTVQKKPFAPEFDLRPVSLTVEKGSEAVFSAHAFGIPLPTYEWSVNGRKVRDGQEGARVTRDESTVDGASILTIDTATYYSEVNHLTISVVAENTLGAEETGAQLTIEPKKPPAPKLTRDLKLQTVNKTDLAHFEVVVEHATECKWFLDGKEITTAQGVTVSKDDQFEFRCSIDTTMFGSGTVSVVASNAAGSVETKTELKVLETPKETKKPEFTDKLRDMEVTKGDTVQMDVIALHSPLYKWYQNGNLLEDGKNGVTIKNEENKSSLIIPNAQDSGKITVEASNEVGSSESSAQLTVNPPSTTPIVVDGPKSVTIKETETAEFKATISGFPAPTVKWTINEKIVEESRTITTIKTEDVYTLKISNAKIEQTGTVKVTAQNSAGQDSKQADLKVEPNVKAPKFKSQLTDKVADEGEPLRWNLELDGPSPGTEVSWLLNGQPLTKSDTVQVVDHGDGTYHVTIAEAKPEMSGTLTAKAKNAAGECETSAKVTVNGGNKKPEFVQAPQNHETTLEESVKFSAIVTGKPMPNVTWYLNNKKLIQSEEVKVKYVHETGKTSIRIQKPLMEHNGTIRVEAENVSGKVQATAQLKVDKKTEVPKFTTNMDDRQVKEGEDVKFTANVEGYPEPSVAWTLNGEPVSKHPNITVTDKDGEHTIEISAVTPEQAGELSCEATNPVGSKKRDVQLAVKKVGDAPTFAKNLEDRLITEGELTLMDAKLNIVKPKPKITWLKDGVEITSDGHYKIVEEEDGSLKLSILQTKLEDKGRITIKAESEFGVAECSASLGVVKGRPMAKPAFQSDIAPINLTEGDTLECKLLITGDPTPFVKWYIGTQLVCATEDTEISNANGVYTMKIHGVTADMTGKIKCVAYNKAGEVSTEGPLKVVAPIPVEFETSLCDATCREGDTLKLRAVLLGEPEPVVSWYVNGKKLEESQNIKIHSEKGTYTVTIKDITCDYSGQVVCEAINEYGKATSEATLLVLPRGEPPDFLEWLSNVRARTGTKVVHKVVFTGDPKPSLTWYINNKEILNSDLYTIVTDDKTSTLTINSFNPDVHVGEIICKAENDAGEVSCTANMITYTSDMFSESESEAQAEEFVGDDLTEDESLREEMHRTPTPVMAPKFITKIKDTKAKKGHSAVFECVVPDTKGVCCKWLKDGKEIELIARIRVQTRTGPEGHITQELVLDNVTPEDAGKYTCIVENTAGKDTCEATLTVIESLEKKSEKKAPEFIVALQDKTTKTSEKVVLECKVIGEPKPKVSWLHDNKTITQESITVESVEGVERVTITSSELSHQGKYTCIAENTEGTSKTEAFLTVQGEAPVFTKELQNKELSIGEKLVLSCSVKGSPQPHVDFYSFSETTKVETKITSSSRIAIEHDQTNTHWRMVISQITKEDIVSYKAIATNSIGTATSTSKITTKVEAPVFEQGLKKTSVKEKEEIKMEVKVGGSAPDVEWFKDDKPVSEDGNHEMKKNPETGVFTLVVKQAATTDAGKYTAKASNPAGTAESSAEAEVTQSLEKPTFVRELVTTEVKINETATLSVTVKGVPDPSVEWLKDGQPVQTDSSHVIAKVEGSGSYSITIKDARLEDSGKYACRATNPAGEAKTEANFAVVKNLVPPEFVEKLSPLEVKEKESTTLSVKVVGTPEPSVEWFKDDTPISIDNVHVIQKQTAVGSFSLTINDARQGDVGIYSCRARNEAGEALTTANFGIIRDSIPPEFTQKLRPLEVREQETLDLKVTVIGTPVPNVEWFKDDKPINIDNSHIFAKDEGSGHHTLTIKQARGEDVGVYTCKATNEAGEAKTTANMAVQEEIEAPLFVQGLKPYEVEQGKPAELVVRVEGKPEPEVKWFKDGVPIAIDNQHVIEKKGENGSHTLVIKDTNNADFGKYTCQATNKAGKDETVGELKIPKYSFEKQTAEEVKPLFIEPLKETFAVEGDTVVLECKVNKESHPQIKFFKNDQPVEIGQHMQLEVLEDGNIKLTIQNAKKEDVGAYRCEAVNVAGKANTNADLKIQFAAKVEEHVTDESGQLEEIGQFETVGDTASSKTDTGRGAPEFVELLRSCTVTEKQQAILKCKVKGEPRPKIKWTKEGKEVEMSARVRAEHKDDGTLTLTFDNVTQADAGEYRCEAENEYGSAWTEGPIIVTLEGAPKIDGEAPDFLQPVKPAVVTVGETAVLEGKISGKPKPSVKWYKNGEELKPSDRVKIENLDDGTQRLTVTNAKLDDMDEYRCEASNEFGDVWSDVTLTVKEPAQVAPGFFKELSAIQVKETETAKFECKVSGTKPDVKWFKDGTPLKEDKRVHFESTDDGTQRLVIEDSKTDDQGNYRIEVSNDAGVANSKVPLTVVPSETLKIKKGLTDVNVTQGTKILLSVEVEGKPKTVKWYKGTETVTSSQTTKIVQVTESEYKLEIESAEMSDTGAYRVVLSTDSFSVESSATVTVTKAAEKISLPSFKKGLADQSVPKGTPLVLEVEIEGKPKDVKWYKNGDEIKDGKVEDLGNGKYRLTIPDFQEKDVGEYSVTAANEAGEIESKAKVNVSAKPEIVSGLVPTTVKQGETATFNVKVKGPVKGVKWYKNGKEIPDAKTKDNGDGSYSLEIPNAQVEDAADYKVVVSNDAGDADSSAALTVKLADDGKDKVKPEIVSGLIPTTVKQGETATFNVKVKGPVKQVKWYKNGKEIPNAKAKDNGDGSYSLEIPNAQLDDTADYKVVVSNDAGDADSSAALTVKLPGIAIVKGLEDAEVPKGKKAVLQVETNKKPKEIKWYKNGKEITPSDKAQPGSDGDNKPQLVIPDAGDDDAAEYKVVLTDEDGNTADSSCALTVKLPAKEPKIIKGLEDQVVSIGSPIKLEIETSGSPKTVKWYKNGKELPGAAAKTIKIQKIDDNKYVLEIPSSVVEDTGDYKVEVANEAGSANSSGKITVEPKITFLKPLKDQSITEGENAEFSVETNTKPRIVKWYKNGQEIKPNSRFIIEQKTDTKYQLVIKNAVRDDADTYKIVLENTAGEAESSAQLTVKKAKAGLCKIVKGLEDQVVAKGAKMVFEVKIQGEPEDVRWLRDANVISAGANAIIEKIDDTTYRLIIPSADLKDAGEYTVEVINESGKAKSDAKGEVDEKPEIVRGLENIEIPEGDDDVFKVEVSAPVRQVKWYKNDQEIKPNSHLEAKKIGPKKYELAINRAQLDDGADYKVVLSNAAGDCDSSAALTVVKPNVLKIVDGLKDVDVEEPQPVELKVKVEGIPKVIKWYKNGQELKPDADGFKFEEKPESGEFSLTIPSSKKSDGGAYRVVLGNDKGEVYSGSVVHVKSAKSSEPTSGANFLSPLKDTEVEEGDMLTLQCTIAGEPFPEVIWEKDGVVLQKDDRITMRVALDGTATLRIRSAKKSDIGQYRVTAKNEAGSATSDCKVTVTEQGEQPSKPKFVIPLKTGAALPGDKKEFNVKVRGLPKPTLQWFLNGIPIKFDDRITLDDMADGNYCLTIRDVREEDFGTLKCIAKNENGTDETVCEFQQGAGHDDGSRDDLRYPPRFNVPLWDRRIPVGDPMFIECHVDANPTAEVEWFKDGKKIEHTAHTEIRNTVDGACRIKIIPFEESDIGVYMCVAVNELGQAETQATYQVEILEHVEEEKRREYAPKINPPLEDKTVNGGQPIRLSCKVDAIPRASVVWYKDGLPLRADSRTSIQYEEDGTATLAINDSTEEDIGAYRCVATNAHGTINTSCSVNVKVPKQEVKKEGEEPFFTKGLVDLWADRGDSFTLKCAVTGDPFPEIKWYRNGQLLRNGPRTVIETSPDGSCSLTVNESTMSDEGIYRCEAENAHGKAKTQATAHVQMALGKTEKPKMDEGKPPKFILELSDMSVSLGNVIDLECKVTGLPNPSVKWSKDGGPLIEDSRFEWSNEASKGVYQLRIKNATVHDEGTYRCVATNENGSATTKSFVRMDDGLGSGVVTASQPPRFTLKMGDVRTTEGQPLKLECKVDASPLPEMVWYKDGAIVTPSDRIQISLSPDGVATLLIPSCVYDDDGIYRVIATNPSGTAQDKGTATVKKLPRDSGARRSADRDVFDANKAPKLMEPLENIRIPEKQSFRLRCKFSGDPKPTIKWFKDGERVFPYGRLQLIESPDGVCELVVDSATRQDAGGYRCVAENTYGSARTSCDVNVIRGDRKPRDIDSSIREGKAPGFTTPLTIRRAKPGDSVTFECLPFGNPFPSIKWLKDGLELFSDEKIKMEAAADGTQRLILSDVTFLSEGYFRCVATNEHGTASTKAELVIEGDRTIGSRPLPEVNGEPEECKPRIRRGLYNMSIHEGNVVEMIVCATGIPTPTVKWYKDGQEIVGDGPDGKRVIFTDERGIHHLVIVNASPDDEGEYSLEATNKLGSAKTEGSLNIIRPRHIADADERGGMPFPPGFVRQLKNKHVFNHMPTIFDCLVVGHPAPEVEWFHNGKKIVPGGRIKIQSCGGGSHALIILDTTLEDAGEYVATAKNSHGSASSSAVLDVTVPFLDSIKFNGEIDVTPYLTEEYGFKKLNTASLPTPPDRGPFIKEVTGHYLTLSWIPTKRAPPRYPQVTYVIEIRELPEKQWSLLEYNIPEPVCKVRNLELGKSYQFRVRAENIYGISDPSPASPPSRLMAPPQPVFDRRTNKVIPLLDPYAEKALDMRYSEQYACAPWFSPGVVEKRYCAENDTLTIVLNVSGFPDPDIKWKFRGWDIDTSSPTSKCKVYTYGGSETTLAITGFSKENVGQYQCFAKNDYGDAQQNIMVDLATRPNFIQPLVNKTFSSAQPMRMDVRVDGEPFPELKWMKEWRPIVESSRIKFVQDGPYLCSLIINDPMWRDSGIYSCVAVNDAGQATTSCTVTVEAEGDYNDVELPRRRVTIESRRVRELYEISEKDEKLAAEGAPFRVKEKATGREFLAQLRPIDDALMRHVDIHNSLDHPGIVQMHRVLRDEKLALVVFDNANSTIDGLSSLAHPGVEIAEPKGVNRETCVRVFVRQLLLALKHMHDLRIAHLDLRPETILLQDDKLKLADFGQARRLLRGLITGEIKGSPEFVSPEIVRSYPLTLATDMWSTGVLTYVLLTGLSPFHGDNDNETLANVDSCQFDSSPLGNFSYDAGDFVKKLLTEIPVSRLTVDEALDHPWINDEKLKTEPLSADTLREFKYQHKWLERRVFVQQTPSEQILEAILGPATAQAQQNAPVAPEGRRPAEIYDYLRIQPKKPPPTVEYVPQPRKEHPPFIDEFGQLIDGDAFDRPEGTGFEGPHRQPPQIPPQPQRPNQAAHDSRRHEQQPQHQGQPQRIPVDQYGRPLVDPRYLNDPSHRPSSLDDAPFYVDKYGNPVHFDKYGRPMAPQNLEKRKLIPQDKGETPSHSKKEKTQHPVATPILASPGGDQQQQKIPMRMIRGERREIEEEIANRILSDISEEGSIAGSLASLEDFEIPKDFQVEASEPSTPTLTPEVTIRETIPKPTPSPTSPQKSPVPQPQGLLIPAKVTYSDSILAGLPAADKKVLEDAENDPSIPVGAPLFLEGLHGSDLTIDTTSASGLIKVTSPAINLSPNPKSPRRSTPGTKSPVVLSPRQEHSMEVLIATKRGKPGFLPPGELAEDIDDEDAFMDDRKKQVKPKDHDGENDFKDEKERLEKDKNRRTVNLDDLDKYRPSAFYKDDSDFGHPGYDIDATPWDSHYQIGPDTYLMAARGAAFNSRVRNYREELFGMGAPTVKQGFLGVRNRDITVRERRRYTDILRETTQGLEPKSHEQSTALLQKAPSATAIERIKADIEKVTPCATKKNDDGTFAPIFTARLRDVYLRKNQPAIFECAVSASPAPKVTWDFQGKILESNDRVTIEQDNNVARLILNHAAPYDLGEYVCTAINEYGTDKSSCRLISGETPSRPGRPEAELSSDTEIFIQWEAPEGPTYLEGITYRLEYRVAGPNDHGDPWITVSEKIDDESVIVKHLSPLGIYQFRVTAQNGFGLGLPSLSSRIVQTHGKGAPKLQIDVLKSEIRLNVVSMPQKSTNQLGGISEESEEDSEARTANEDMKSNLQLQTDDPTGRFQIGGLKFKGRFSVIRDAVDSTTEGHAHCAVKIRHPSSEAISEYESLRDGQHENVQRLIAAFNNSNFLYLLSERLYEDVFSRFVFNDYYTEEQVALTMRQVTSALHFLHFKGIAHLDVNPHNIMFQSKRSWVVKLVDFGRAQKVSGAVKPVDFDTKWASPEFHIPETPVTVQSDMWGMGVVTFCLLAGFHPFTSEYDREEEIKENVINVKCDPNLIPVNASQECLSFATWALKKSPVRRMRTDEALSHKFLSSDPSMVRRRESIKYSASRLRKLAAMIRQPTFSQPISEELESKYGK"
misc_feature 274..288 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature <289..495 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 313..327 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 391..405 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 433..450 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 472..483 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 523..792 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 574..588 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 613..627 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 688..702 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 730..747 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 769..780 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 823..1092 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 874..888 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 913..927 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 988..1002 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1030..1047 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1069..1080 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1111..1386 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 1162..1176 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1201..1215 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1279..1293 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1324..1341 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1363..1374 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1417..1683 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 1468..1482 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1507..1521 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1585..1599 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1609..1638 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1660..1671 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1711..1980 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 1762..1776 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1801..1815 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1876..1890 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1918..1935 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1957..1968 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1999..2292 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 2050..2064 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2089..2103 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2179..2193 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2203..2247 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2269..2280 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2605..2865 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 2656..2670 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2689..2703 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2767..2781 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2803..2820 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2842..2853 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2902..3153 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 2935..2949 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2974..2988 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3049..3063 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3091..3108 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3130..3141 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 3172..3447 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 3223..3237 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 3265..3279 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3337..3357 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3385..3402 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3424..3435 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 3466..3741 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 3517..3531 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 3556..3570 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3637..3651 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3679..3696 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3718..3729 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 3760..4029 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 3811..3825 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 3850..3864 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3925..3939 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3967..3984 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 4006..4017 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 4048..4323 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 4099..4113 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 4141..4155 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 4219..4233 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 4261..4278 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 4300..4311 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 4348..4617 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 4438..4452 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 4513..4527 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 4555..4572 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 4594..4605 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 4636..4902 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 4684..4698 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 4723..4737 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 4798..4812 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 4840..4857 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 4879..4890 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 4921..5190 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 5011..5025 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 5086..5100 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 5131..5148 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 5170..5181 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 5320..5604 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 5371..5385 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 5410..5424 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 5500..5514 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 5542..5559 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 5581..5592 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 5641..5907 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 5692..5706 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 5731..5745 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 5797..5817 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 5845..5862 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 5884..5895 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 5920..6210 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 5971..5985 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6010..6024 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6106..6123 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6151..6168 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6226..6498 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 6277..6291 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6313..6327 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6394..6408 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6436..6453 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6475..6486 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6517..6792 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 6568..6582 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6607..6621 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6688..6702 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6730..6747 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6769..6780 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6811..7077 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 6862..6876 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6901..6915 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6982..6996 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 7024..7041 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 7063..7074 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 7105..7380 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 7156..7170 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 7195..7209 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 7276..7290 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 7318..7335 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 7357..7368 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 7399..7674 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 7450..7464 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 7489..7503 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 7570..7584 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 7612..7629 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 7651..7662 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 7717..7989 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 7768..7782 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 7807..7821 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 7885..7899 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 7927..7944 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 7966..7977 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 8110..8367 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 8161..8175 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 8200..8214 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8278..8292 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8320..8337 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8359..8370 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 8419..8691 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 8470..8484 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 8509..8523 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8581..8601 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8629..8646 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8668..8679 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 8713..8982 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 8764..8778 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 8800..8814 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8878..8892 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8920..8937 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8959..8970 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 9001..9267 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 9049..9063 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9085..9099 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9205..9222 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9244..9255 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 9295..9555 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 9346..9360 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9382..9396 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9451..9465 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9493..9510 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9532..9543 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 9565..9825 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 9616..9630 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9652..9666 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9721..9735 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9763..9780 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9802..9813 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 9859..10119 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 9910..9924 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9946..9960 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10015..10029 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10057..10074 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 10096..10107 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10138..10407 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 10183..10197 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10219..10233 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10297..10311 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10339..10356 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 10381..10392 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10423..10698 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 10474..10488 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10510..10524 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10594..10608 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10636..10653 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 10675..10686 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10714..10977 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 10759..10773 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10795..10809 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10873..10887 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10915..10932 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 10954..10965 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11002..11268 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 11050..11064 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11089..11100 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11164..11178 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11206..11223 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 11245..11256 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11278..11547 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 11329..11343 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11365..11379 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11443..11457 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11485..11502 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 11524..11535 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11596..11841 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 11614..11628 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11650..11664 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11734..11748 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11776..11793 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 11815..11826 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11878..12144 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 11923..11937 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11962..11976 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12040..12054 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12082..12099 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12121..12132 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12172..12441 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 12223..12237 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12262..12276 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12340..12354 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12382..12399 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12427..12438 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12490..12762 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 12541..12555 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12580..12594 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12658..12672 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12700..12717 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12739..12750 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12808..13080 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 12859..12873 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12898..12912 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12976..12990 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13018..13035 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 13057..13068 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13120..13392 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 13171..13185 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13210..13224 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13288..13302 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13330..13347 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 13372..13383 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13444..13713 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 13534..13548 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13609..13629 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13657..13674 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 13699..13710 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13762..14034 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 13813..13827 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13852..13866 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13930..13944 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13972..13989 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 14104..14376 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 14155..14169 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 14194..14208 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 14272..14286 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 14314..14331 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 14353..14364 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 14434..14706 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 14485..14499 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 14524..14538 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 14602..14616 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 14644..14661 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 14683..14694 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 14773..15054 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 14824..14838 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 14863..14877 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 14950..14964 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 14992..15009 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 15031..15042 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 15109..15381 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 15160..15174 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 15199..15213 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 15277..15291 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 15319..15336 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 15358..15369 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 15484..15735 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Fibronectin type 3 domain; Region: FN3; smart00060" /db_xref="CDD:214495" misc_feature order(15484..15486,15685..15687,15730..15732) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature <15958..16146 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 15979..15993 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 16066..16080 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 16108..16125 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 16189..16452 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="immunoglobulin-like domain of telokin and similar proteins; a member of the I-set of IgSF domains; Region: IgI_telokin-like; cd20973" /db_xref="CDD:409565" misc_feature 16189..16200 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand A [structural motif]; Region: Ig strand A" /db_xref="CDD:409565" misc_feature 16204..16215 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand A' [structural motif]; Region: Ig strand A'" /db_xref="CDD:409565" misc_feature 16225..16254 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409565" misc_feature 16267..16287 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409565" misc_feature 16294..16302 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C' [structural motif]; Region: Ig strand C'" /db_xref="CDD:409565" misc_feature 16318..16335 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand D [structural motif]; Region: Ig strand D" /db_xref="CDD:409565" misc_feature 16342..16368 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409565" misc_feature 16390..16413 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409565" misc_feature 16420..16452 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409565" misc_feature 16519..17295 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="The protein kinase superfamily is mainly composed of the catalytic domains of serine/threonine-specific and tyrosine-specific protein kinases. It also includes RIO kinases, which are atypical serine protein kinases, aminoglycoside phosphotransferases; Region: Protein Kinases, catalytic domain; cl21453" /db_xref="CDD:473864" misc_feature order(16552..16563,16570..16572,16576..16578,16615..16617, 16621..16623,16693..16695,16744..16755,16906..16908, 16918..16923,16927..16929,16954..16959) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:270870" misc_feature 19243..19509 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 19294..19308 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 19333..19347 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 19408..19422 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 19450..19467 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 19489..19500 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 19522..19809 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature order(19522..19524,19729..19731,19774..19776) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature order(19777..19782,19786..19791) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature 20002..20766 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Catalytic kinase domain, second repeat, of the Giant Serine/Threonine Kinase Uncoordinated protein 89; Region: STKc_Unc-89_rpt2; cd14112" /db_xref="CDD:271014" misc_feature order(20032..20046,20050..20052,20056..20058,20101..20103, 20107..20109,20179..20181,20227..20232,20236..20238, 20245..20247,20251..20253,20362..20364,20368..20370, 20374..20379,20383..20385,20419..20424,20431..20433, 20470..20481) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="active site" /db_xref="CDD:271014" misc_feature order(20032..20046,20050..20052,20056..20058,20101..20103, 20107..20109,20179..20181,20227..20232,20236..20238, 20245..20247,20374..20379,20383..20385,20419..20424) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:271014" misc_feature order(20044..20046,20245..20247,20251..20253,20362..20364, 20368..20370,20374..20376,20431..20433,20470..20481) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="polypeptide substrate binding site [polypeptide binding]; other site" /db_xref="CDD:271014" misc_feature order(20419..20457,20461..20481) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="activation loop (A-loop); other site" /db_xref="CDD:271014" ORIGIN
atggtgctcaagacgctctatattatcgagctaaccgataccgaggaaggaggtctcgagctcgtcgatccatcatggtgtccagaagaaggaggtccaccacgaaagaaggtaaaatcaccgccggtgatttcacctaccggctcgtccaccagtatctattcaggaggaagtagtagtattgattggacaacaactggaacgacactcgaaatgcaaggaacgcgtgtaaccagaacccaatacggtttcagaaccttgcaagaatcatcagcgaaaatgtgtctgaaagtaactggatatccattacctgatatcacatggtacaaagatgatgtacaacttcatgaagatgagagacacactttttattcggatgaagatggtttctttgcgatgaccattgatccagttcaggtgaccgacactggtcgttacacatgtatggcaacaaacgaatacggtcaggcatccacttctgcctttttccgagttttgaaagtcgaaaaagaagctgctccaccagcatttgtcacaaaactcagagacaaagaatgcaaagaaggtgatgttattgatttcgaatgtgaagttgaaggatggcctgaaccggaacttgtatggcttgtcgacgatcagccactccgaccatcccacgactttcggctgcaatatgatggacagacggcaaagctcgaaattcgtgatgctcagccggatgatactggagtctatacagtcaagattcaaaatgagttcggatcgattgaaagcaaggctgagctctttgttcaagcagatccagataagaaccatgtggctccagagttccaggcaacaattgaatatgttgagtgtgatgagggagaggaagttcgattcaagtcagttattactggagatcctaatccagaaatcatttggttcatcaatggaaaaccactgagtgaatcagaaaaagtcaagttcatctcggaagatggaatctgcatcttaacgattaaagacgtaaccaggcatttcgatggaatggttacatgtcaaggatcaaacagattgggttcagcgtcttgtgatggaaggctaaaagtcagagttccaccagcaccaccaacctttaataagccactcgaagataagacagtccaggagaagagtactgttgtgttcgaagtggatgtcagcggatggccagagccaacactaaccttcacactttgcggaaaagagttgaaaaacggtgaagaaggcgttgaaatcgtagggcacgacggtttctatcgcatttcgatcccgaacacatcgatggacaagcacgacggtgaaattgtggcaaaggctcaaaatgagcatggaaccgcggagagtagggcacggctcactgtggaacaggaggaggaggagtcgcgcagtgcgccgactttcttgaaggatattgaagatcaaaccgtaaaaaccggcgagttcgccgtcttcgagacaaccgttcgcggaaatccgaatccggaggttacttggttcatcaacgggcacaagatggatcagggcagtccgggcgtcaagatcgaggcgcacaatcacgaccataagctgactatcgactcggcacagtacgcgggcaccgtactctgcagagctgaaaatgctgttggacgattcgaaacgaaagcccgactcgttgttctggccccagaaaaacagaagaaaccaccgaaattcgtggagattcttgtcgacaaaaccgaaaccgtcgacaacacagttgtgtttgaagttcgcgttgaaggtgaaccaaaaccgactgtaacatggtatttaaaaggagaagaactcaaacaatcggatcgcgtcgagattcgagaattcgatggatcaataaaaatctcaatcaagaacatcaaaattgaagatgccggagagatcagggctgttgcgacaaactctgaaggatctgatgagacgaaggcgaaattgactgttcagaagaagccattcgctccagaatttgatttgcgaccagttagcttgacagtcgaaaagggatccgaagcagttttcagtgcacacgcttttggtattccattgccaacttatgaatggtctgtcaatggaagaaaggtgcgagatggacaggaaggggcgcgcgtaacacgtgacgagagcaccgtcgacggcgcatcgatcctgacgatcgacacggcgacatactattccgaagtgaaccatctgacaatttctgttgtcgcagaaaacacactcggagccgaagagacgggcgcccagttgacgatcgagccgaagaagcctccagcgccaaagctcactcgcgacctcaaattgcagacagtcaacaagaccgacttggcccatttcgaagttgtcgttgaacatgcaaccgagtgcaaatggttcttggatggaaaagagattacgacagcccaaggggttacggtttcaaaggacgatcaatttgaattccgttgctcaattgatacaaccatgtttggaagtggaactgtgtctgttgtggcttcaaatgctgctggttccgtggagactaagactgaattgaaggttttggaaactccaaaggaaaccaagaaaccagaattcactgacaagctcagagatatggaagtcacaaagggagatacagtacagatggacgtcatcgccctacactcgcctctatacaaatggtaccaaaatggaaatctgttggaagatggaaagaatggagttaccattaagaacgaggaaaacaaatcttcattgatcattccaaatgctcaagattctggaaagatcacagttgaagcttcgaacgaagtcggatcatctgaatcctctgctcaactgactgtcaatccaccatcaactaccccaattgttgttgatggaccaaagtcggtgactatcaaggaaacggaaactgctgagttcaaggcaacaattagcggattcccagcaccaactgtcaaatggacgattaatgaaaagatcgtagaggaatctagaactatcaccactatcaagacggaagacgtctatactttgaagatctctaatgcaaagatcgagcagactggaactgtgaaagttactgctcaaaattcagctggacaggatagcaagcaagctgaccttaaggttgaaccaaatgtgaaagctccaaagttcaagtctcagctcactgataaggttgctgatgaaggagaaccactccgttggaatcttgaattggatgggccatcacctggaactgaagtctcttggcttcttaacggacagccacttacaaagagtgatactgttcaagtagtcgatcatggagatggaacttatcatgtgacgattgcagaggccaagccagaaatgtctggaactcttacagcaaaagcaaagaacgccgcaggagagtgtgagacatcggcaaaggttactgtgaatggaggaaacaagaaaccagaatttgttcaagctccacaaaatcacgagacaactcttgaagaaagtgttaagttcagcgctattgttactggaaaaccaatgccaaatgtgacatggtatttgaacaacaagaagttgatccagagtgaggaggttaaagtgaagtatgttcatgagactggaaagacatcaatccgcattcaaaagccactcatggagcacaatggaactatccgcgttgaagctgagaatgtgtcaggaaaggttcaagccacagctcaattgaaggttgacaaaaagactgaagttccaaagttcactacgaacatggatgatcgtcaagtcaaagagggagaagatgtgaagttcactgcaaatgtggaaggataccctgaaccatctgtagcatggactttgaatggagaaccagtttctaagcatccaaacatcactgttaccgacaaggacggagagcacaccatcgaaatttccgccgtcacacccgaacaagctggagagctgtcttgcgaagcgacaaaccccgtcggatccaaaaagagagatgttcaactcgctgttaaaaaggtcggtgatgcaccaacgtttgcaaagaatctcgaagatcggttgatcaccgagggagagttgacattgatggatgctaaattaaacattgtaaaaccaaagccaaagatcacctggcttaaggatggtgttgaaattacttctgatgggcattataagattgttgaagaggaagatggatccttgaaacttagcattcttcaaactaaactggaagataagggaagaatcacgattaaagcggaaagcgaatttggcgttgcggaatgttcagcatctcttggagttgttaagggacgcccaatggccaaaccagcattccaaagtgatattgcaccaattaacctcaccgaaggagatacccttgaatgcaagcttctcatcaccggagacccaacacctttcgtcaagtggtacattggaacacaactcgtttgtgccactgaagatactgagatctctaatgccaatggagtttacactatgaagattcatggtgtgactgctgacatgactggaaagatcaagtgcgtcgcatacaataaggctggagaagtgagcaccgagggtccactcaaggttgttgcaccgattccggttgaatttgaaacatctctatgtgatgctacctgcagagaaggagatactctcaaattgagggcagtattgctcggagagccagaaccagttgtctcgtggtatgtgaacggaaagaagttggaagaatctcagaatatcaagattcattctgagaaaggaacatacacggttacaatcaaagacatcacatgcgattattctggacaagtcgtctgcgaggcaatcaacgagtatggaaaagcaacatctgaggctacattgctcgtgctgccacgtggtgaacctccagatttcttggaatggctcagcaatgttcgcgcaagaactggaaccaaggtcgtgcacaaggttgtcttcacaggagacccgaaaccaagccttacatggtacatcaataataaggagattctcaactcggatctttacaccatcgtcacagatgataaaacatcaacgttgacaatcaacagcttcaacccagatgttcatgttggagaaattatctgcaaggccgagaacgatgctggagaagtttcctgtaccgcaaacatgatcacctacacatctgacatgttcagtgaatctgaaagtgaagcccaagctgaagaatttgtcggagacgatctcactgaagatgagagtcttcgagaggaaatgcaccgtactccaactccagttatggcacccaaattcatcacaaagatcaaggataccaaagccaagaagggacactctgctgtctttgaatgcgttgttccagacaccaagggagtgtgctgcaagtggttgaaggacggaaaagagattgagctgattgccagaatccgggttcaaactagaactggaccagagggacacatcactcaagaacttgtcctcgacaacgtcactccagaagatgccggcaagtacacgtgcatcgttgagaacaccgccggaaaagatacctgtgaggcgacgctaactgtcattgaatcattggagaagaagtcggagaaaaaagctccagaattcattgttgctcttcaagataagacaacaaagacatccgagaaggttgttcttgaatgcaaagtcatcggagagccaaagccgaaagtcagctggcttcacgataataagacaattactcaagagtctatcacagttgaatcagtggaaggcgtcgaaagagtcacaatcacttcatctgaattgtctcatcaaggaaaatacacctgcattgccgagaacactgaaggaacatctaagactgaagcattcttgactgtccaaggcgaagctccagtgttcacaaaggaactgcagaacaaggagttatcaattggagagaagctcgttctctcgtgttctgtcaaaggatccccacagccgcatgtcgatttttattcgttctcggaaactacgaaggtggagacgaagatcacctcatccagtcgaatcgccattgagcatgaccagaccaatacgcattggagaatggttatcagtcaaatcacaaaagaagatattgtctcctacaaagctattgccacaaattcaattggaactgctacttcaacatcaaagatcaccacgaaggtagaggcaccagtctttgagcaaggattaaagaagacaagtgtgaaggagaaggaagaaattaagatggaagtaaaggtcggaggaagtgctccagatgttgaatggtttaaggatgacaaaccagtcagtgaagatggaaatcatgagatgaagaagaatccagaaactggagtgtttactctggttgtgaaacaagctgcaactacagatgctggaaagtataccgccaaggcttccaatccagcaggtactgctgaatcttctgcagaggctgaggtcactcaatctctcgagaaaccaactttcgtgagggaacttgtcacaactgaagtcaagatcaatgaaactgcaactttgtccgttacagtgaaaggagttccagatccgagtgttgaatggcttaaggatggacaaccagtgcaaactgattcaagtcatgtgattgctaaggttgaaggatccggaagctactcgattaccattaaggatgcgagactcgaggactctggaaagtacgcatgccgtgcaaccaatccagcaggtgaagccaaaactgaggctaactttgcagttgtcaagaacttggttccaccagaatttgttgagaaactcagtccactcgaagtgaaggagaaggaaagtaccaccttgtccgtcaaggttgtaggaacaccagaaccatctgttgaatggttcaaggatgatactccaattagtatcgacaatgttcatgtcattcagaagcagacagctgttggatccttcagtttaaccatcaatgacgcgagacagggagatgttggaatctactcttgccgtgctaggaatgaagctggggaagctcttacaacagcgaactttggaatcatcagggattctattccaccagagtttactcaaaaacttcgaccacttgaagtcagagagcaggagactcttgatttgaaagttactgtaattggaaccccagtaccaaatgttgaatggttcaaggatgataagccaatcaatattgataactcgcacatttttgcaaaggatgaaggatcaggacatcatactctcacaattaaacaagctagaggagaagatgttggagtctacacctgcaaagccaccaacgaagccggagaagccaaaaccactgcaaacatggctgttcaagaagagattgaagcaccattgtttgttcaaggcctgaaaccatacgaggtggaacaaggcaagccagctgaattggtggttcgtgtagaaggaaagccagagcctgaggttaaatggttcaaggatggagttccgattgctattgacaatcagcatgtgattgagaagaagggagagaatggatctcatactcttgtcatcaaagacaccaacaatgctgacttcggaaagtacacatgccaagctacaaacaaggctggaaaggatgaaactgttggagagctcaagattccaaagtattcattcgaaaagcaaactgctgaagaagtcaagccactgttcattgagccactaaaggaaacatttgccgttgaaggagataccgttgttcttgaatgcaaggtgaacaaggaatcacatccacaaatcaagttcttcaagaatgatcaaccagtggagattggacaacacatgcaattggaagtattggaagatggaaatatcaagctcacaattcaaaatgccaagaaagaagacgttggtgcatatcgttgcgaggctgtgaatgttgccggaaaggccaacacgaatgctgatttgaagattcaattcgctgctaaagttgaagaacatgtcaccgatgaaagtggccagcttgaggagattggacagtttgagactgtcggagatactgcatcctctaagaccgacactggacgtggagctccagaatttgtggagcttctccgttcgtgtacagttaccgagaagcaacaagcgatccttaagtgcaaggtgaaaggagagccacgaccaaagatcaagtggactaaggaaggaaaggaggtcgaaatgtcggcacgtgttcgcgctgagcacaaggatgatggaactttgacgctgacatttgataatgttactcaagccgacgccggagaatacagatgtgaggctgagaacgagtatggaagtgcatggaccgaagggccaattattgtcacattggaaggagctccaaagattgacggtgaagctccagacttcttgcaaccagtcaagccagctgttgttacagttggtgagactgcagttcttgaaggaaagatttctggaaaaccgaaaccaagtgttaaatggtacaagaatggagaagagctcaagccatccgatagagttaagattgagaatttggatgatggaactcaaagactcaccgttaccaacgctaaactcgacgatatggatgagtaccgctgtgaagcttcaaatgagtttggagatgtttggagtgacgtcactcttacagtcaaggaaccagctcaagttgctccaggattcttcaaggaactctctgctattcaggttaaggagactgaaaccgccaagtttgaatgcaaggtttcgggaactaagccagatgtgaaatggttcaaggacggaactccattgaaggaagacaaacgagtgcacttcgaatcaaccgacgatggaactcaaagacttgtcatcgaagattccaagactgatgatcaaggaaactaccgtattgaagtttccaatgatgctggagttgcgaacagcaaggttccactcacagtcgttccatcagaaaccctcaagatcaagaagggactcacagatgtaaatgttacacagggaaccaagatccttctctctgttgaagttgaaggaaaaccaaaaactgtcaaatggtacaagggaacagaaactgtcaccagctcccagaccacaaagatcgtgcaggtgaccgagtcagaatacaagttagaaatcgaaagcgctgagatgtctgatactggagcttaccgcgttgttctctctactgattcgttttctgttgagtcgtctgctacagtaactgtcaccaaggctgctgaaaagattagtcttccttcattcaagaagggactcgctgatcaatccgttccaaagggaactccattggttttggaagttgaaatcgaaggaaagccaaaagatgttaaatggtataagaatggagatgagatcaaggacgggaaggtcgaggatcttggaaacggaaaataccgactcacaattccagacttccaagagaaagatgttggagagtacagtgtcactgctgctaacgaggctggagaaattgaatcaaaggccaaggtaaacgtgagtgccaagcctgaaattgtttctgggctggtaccaactactgtgaagcaaggagaaactgccacctttaacgtcaaggtcaagggaccagtcaagggagtcaagtggtacaagaacggaaaagagattcctgatgctaaaacaaaggacaatggagatggatcctactctcttgagattccaaacgctcaagttgaagatgcagctgactataaggttgttgtctccaatgatgctggagatgctgattcttcagctgctcttaccgtcaaacttgctgacgatggaaaggataaggtgaaaccagaaattgtatcgggacttattccaactacagtgaagcaaggagaaactgccacctttaacgtcaaggtcaagggtccagtgaaacaggtcaagtggtataagaatggaaaagaaattcccaacgccaaggctaaggacaacggagatggatcctactctctggaaattccaaacgcgcaacttgatgacactgccgactacaaggttgttgtgtcgaatgatgctggagatgctgattcttcagctgctcttactgttaagcttcctggaatcgctattgttaagggacttgaagacgccgaagtgccaaagggcaagaaggctgttctccaagttgaaaccaacaagaagccaaaggaaattaaatggtataagaatggaaaggagattactccaagcgacaaggcacaacccggaagcgacggagacaacaaaccacagctggttattccagatgctggtgacgatgatgctgctgaatataaggttgtgttgactgatgaagatggaaatactgccgattcgtcatgcgccttgactgttaaattaccagcaaaagagccaaagatcatcaaaggactcgaggatcaagtggtgtcgattggatctccaattaagttggaaatcgaaacttctggatcaccgaagactgtgaaatggtacaaaaacggaaaggagcttccaggagctgccgccaagaccatcaagattcagaagatcgacgataacaagtatgttcttgagatcccatccagtgttgttgaagataccggagactacaaagtcgaagttgccaacgaggcaggatctgcaaacagcagtggaaagatcactgtggaaccaaagatcacgttcttaaagccactgaaggatcaatcgatcactgagggagaaaatgccgaattctcagttgaaaccaacaccaagccaagaattgtcaaatggtataagaatggacaagaaattaagccaaattcccgattcatcattgaacaaaagactgataccaagtatcaacttgttattaagaacgctgttcgtgatgatgcagacacctacaagattgttcttgaaaacaccgctggagaagccgaatcttctgctcaattgactgttaagaaagctaaggctggactctgcaagatcgtcaaaggtcttgaagaccaggttgttgccaagggtgccaagatggtatttgaggttaagatccaaggagagccagaggatgtcagatggcttcgtgatgcaaatgttatcagtgcaggagctaatgcaatcattgagaaaattgatgacaccacctacaggttgataattccatccgctgatttgaaggatgctggtgaatacactgtcgaagtaatcaatgagagtggaaaagccaagagtgatgcaaagggagaggttgatgagaaaccagagattgttcgaggacttgagaacatcgaaattccagagggagatgacgatgtgttcaaggttgaagtcagtgctccagtcagacaagtcaaatggtataaaaatgaccaggagatcaaaccaaacagccatttggaagccaaaaagatcggtccaaagaagtacgaacttgctatcaaccgtgctcaattggacgatggagccgactacaaggttgtgctatcgaatgctgcaggagattgtgattcttccgcggctctcactgttgtcaagccaaatgttctgaagattgtcgatggattgaaggatgttgatgttgaggaaccccaaccagttgaacttaaggtcaaggttgagggtattccaaaggttattaaatggtacaagaacggacaggagcttaagccagatgctgacggattcaaatttgaagagaaaccagaatctggagagttctctctcactatcccatcgtctaagaaatctgatgggggtgcataccgtgttgttcttggaaatgacaagggagaagtatacagtggatctgttgttcatgttaaatctgccaaatcatccgaaccaacatcaggagccaacttcctctccccactcaaggataccgaggttgaagaaggagatatgctcactcttcagtgcactattgctggagaaccattccccgaagtcatctgggagaaggatggtgttgtccttcagaaggatgatagaatcacgatgagagtcgcacttgatggtactgctaccctcagaattcgttctgccaagaagagtgacattggacaatatcgtgttactgcgaagaacgaagctggaagcgctacaagtgactgcaaggttaccgtcactgaacaaggagagcaaccatcgaagccaaagttcgttattccattgaagacgggagcagctcttccaggcgacaagaaggaattcaatgtgaaggttcgaggacttccaaagccaacattgcaatggttcttgaacggaatcccaatcaaattcgatgatagaatcaccctcgatgacatggctgatggaaactactgtcttacgattcgtgacgttcgtgaagaagacttcggaaccttgaagtgtattgcaaagaatgagaatggaacagatgaaactgtctgtgaattccaacaaggtgctggacacgatgatggatctagagacgatcttcgttatccaccaagattcaatgttccactttgggacagaagaatccctgttggtgacccaatgttcatcgagtgtcatgttgatgccaacccgaccgccgaagttgaatggttcaaggatggaaagaagatcgaacacactgcacataccgaaatcagaaacaccgttgatggagcatgtcgcatcaagatcattccattcgaggagtctgatattggagtttacatgtgcgttgctgtaaacgagttgggacaagctgaaactcaagccacataccaagttgagattttggaacatgtggaggaggagaagcgccgagaatatgctccaaagattaatccaccattggaagataaaactgtcaatggaggtcaaccaatcagattatcatgcaaggttgacgctatcccaagagcttcagtggtttggtacaaggatggacttccacttcgtgctgattctagaacctctattcaatatgaagaggatggtacagctacccttgcgatcaatgacagtaccgaggaagacattggagcataccgttgtgttgctacaaatgctcatggaacgatcaacaccagttgcagtgtgaacgtcaaggttccgaagcaggaagtcaagaaggagggagaagagccattcttcacaaagggacttgtcgatttgtgggcggatcgtggagattcgttcactttgaagtgcgcagtcaccggagatccattcccagaaatcaagtggtacagaaatggacaacttcttagaaatggaccaagaactgttattgaaacatcgccagatggttcatgttcacttactgtcaatgaatctacaatgagtgatgaaggaatctatcgatgtgaagctgaaaatgctcatggaaaggccaagactcaagctactgctcatgtgcaaatggctcttggaaagactgaaaaaccaaaaatggatgaaggaaaaccaccaaagttcattttggagctttctgatatgtcagtttctcttggaaatgttattgatttggaatgcaaggttaccggactaccaaatccatcagtcaaatggtcgaaggatggaggtccactgattgaggactccagattcgaatggtccaatgaagccagcaagggagtctatcagctcagaatcaagaacgccaccgtacatgacgagggaacttatcgctgcgttgccacaaatgagaatggaagtgctactaccaagtcatttgtaagaatggatgatggtcttggatcaggtgttgtgactgccagtcagccaccaagattcactttgaagatgggagatgttcgtacaactgaaggacaaccattaaaattggagtgtaaggttgacgctagcccacttccagagatggtttggtataaggatggagccattgttacaccatctgacagaattcaaattagtctgtcacctgatggagttgcaactcttcttatcccatcttgcgtctatgatgatgatggaatctaccgtgtaattgccaccaacccatctggaactgcccaggataagggaactgctactgttaagaaacttccaagagatagcggtgccagaaggtctgctgacagagatgtatttgatgctaacaaggcaccaaagcttatggagccactggagaatatcagaattcccgaaaagcagtcgttccgtcttcgttgcaagttcagcggagatccaaagccaacaatcaaatggttcaaggatggagaacgtgtattcccatacggacgtcttcaactcatcgagtctccagatggtgtctgtgagttggtggttgattctgccactcgtcaagatgctggaggatacagatgcgttgctgaaaacacttatggatctgctagaacatcttgcgatgttaatgttattcgcggtgatcgtaagccacgcgacattgactcgtccattcgtgaaggaaaggctccaggattcaccaccccattgacaatccgtcgtgctaagccaggagattccgtgacattcgaatgccttccattcggaaatccattcccatcaatcaagtggcttaaggatggacttgagctgttctctgatgaaaagatcaagatggaagctgctgcagatggaacccagcgactcattctttccgatgtcaccttcttgagtgaaggatacttcagatgtgtagctaccaatgagcatggaactgcttctacaaaggctgaacttgtcatcgaaggagaccgaactattggatcccgcccacttccagaagtaaacggagagcctgaagaatgcaagccaagaatccgtcgtggactgtacaacatgagtattcacgagggtaatgttgtggagatgatcgtctgtgcaactggtatcccaacgccaactgtcaagtggtacaaggatggacaggagattgtcggagatggacctgatggaaagagggtcatctttacggatgaacgaggaattcatcacttggttattgtgaatgcatctccagatgatgaaggagagtactcgttggaagcaacgaataagttgggatcagccaagaccgaaggatccttgaacattatcagaccaagacatattgcagatgctgacgagagaggaggcatgccattcccaccaggattcgtgcgtcaactaaagaacaagcacgtcttcaatcacatgccaacaatcttcgactgccttgttgtcggacacccagcccctgaagtagagtggttccacaatggaaagaagattgttccaggaggacgaatcaagattcaatcgtgtggaggaggatctcatgccctcatcattctcgatacaacccttgaagatgcaggagagtacgttgctactgcgaagaactctcatggatccgccagctcatcagcagtgcttgatgtgactgttccattcctggacagcatcaagttcaatggagagattgatgtgactccatacctcaccgaggaatatggattcaagaagcttaacaccgccagtctcccaactccaccagatcgtggaccattcatcaaggaggtcaccggacattatcttacactctcatggattccaacaaagagagctccaccacgttatccacaagtcacatatgttattgagattcgtgaacttccagagaaacaatggtctctcttggagtataacattccagagccagtatgcaaggttcgtaatttggaactcggaaagtcatatcaattccgtgttcgtgctgagaacatctatggaatctctgatccatcgccagcatctccaccatcaagactcatggctccaccacaaccagtattcgatagaagaacgaacaaagttattccacttcttgacccatatgcagaaaaagctcttgatatgagatactctgaacagtacgcgtgtgctccatggttctcaccaggagtcgttgagaagcgatactgcgccgagaacgataccctcacaattgttctgaatgtgtccggattcccggatccagatatcaaatggaagttccgtggatgggatattgacacgtcatcgccaacctctaaatgcaaagtgtacacttatggaggttccgagacaacattagccatcactggattcagcaaggagaatgttggacaatatcaatgtttcgccaagaacgattacggagatgcacaacaaaatattatggttgatcttgcaacacgaccaaacttcatccaaccactcgtgaacaagaccttctcatcagctcagccaatgagaatggacgtgagagtcgacggagaacctttcccagaattgaaatggatgaaggaatggcgcccaattgtcgagtcgtctcgcatcaagtttgttcaagacggaccttatttgtgctctttgatcattaatgatccaatgtggagagactccggaatctattcatgtgttgctgtaaatgatgccggacaagccacgacgtcgtgtactgttactgttgaagctgaaggcgactacaatgacgtcgaacttccccgtcgccgagtgacaatcgaatcgcgacgagtgcgagagctctacgaaatctctgaaaaagacgaaaagttggcggccgaaggagcaccatttcgagtcaaagaaaaagccacgggacgcgagtttttggcgcagttgagaccgatcgatgatgctctaatgcgccacgtggatatccacaattcgttggatcatccaggaattgtgcaaatgcatcgggtgcttagagatgagaaattggcattggtggtgtttgataatgcaaactcaactatcgacggcctctcaagccttgcgcaccctggcgtcgaaattgctgagccaaaaggagtcaaccgtgaaacatgtgttcgtgtctttgttcgtcaacttcttcttgctctcaagcacatgcatgatttgcgaattgcccatctagatctccgtcccgaaaccattcttcttcaagatgataagctgaaattagcagacttcggtcaagcaagacgccttctacgcggccttatcaccggagaaatcaagggatcgcccgagttcgtgagccctgaaatcgtgagaagttacccattgaccctggcaactgatatgtggagtactggagttttgacatatgtattactaaccggattgtcaccattccacggagataatgacaatgagacccttgcaaacgttgatagttgccaatttgattcgtctcctcttggcaacttctcctatgacgccggagatttcgtcaagaaactgttgaccgagattccagtctcacgtttgacagttgatgaagcattagaccatccatggattaacgatgaaaagctgaaaactgaacctttgtcagctgacacgttgagggaattcaaatatcagcataagtggctggaacgtcgcgtgttcgttcaacagacgccgtccgaacagattcttgaagcaattcttggtccggcaacggcacaagctcaacaaaatgctcctgtagcaccggaaggtcgacgtcctgctgaaatttacgactatctgagaattcagccgaaaaagccaccaccgactgtggaatacgttccacaacctagaaaagagcatccgccgtttattgacgaattcggacaacttattgacggagacgcttttgatcgaccagagggtactggatttgaaggaccacatagacaaccaccacaaattccacctcaacctcaacgaccgaaccaggcagctcacgattcgagacgacacgaacaacaaccacaacatcaggggcaaccacagcgaattcctgttgatcaatacggtcgtccgctagtcgacccacgttacctgaacgatccatcgcaccgcccgagttcccttgacgacgctccattctacgtggacaaatacggaaatccggtgcactttgacaaatacggtagaccaatggctccacaaaacttggaaaagcgaaagcttatcccacaagacaaaggagaaaccccatctcattccaaaaaagaaaagactcagcatccagttgctacaccgattctagcatcgccgggaggagatcaacagcagcagaagatcccgatgagaatgatccgtggggaacgaagagaaatcgaagaggaaattgcgaatagaatattatcagatatttctgaagaaggatcaattgctggttcacttgccagtttggaagattttgagattcccaaggatttccaagtagaggcatctgagccatcaacaccaactctcacaccagaagtaacaatcagagagactattccaaagccaacaccatctccaacatccccacagaaatctccagttccacaaccacaaggtctcttgattccagcaaaggtcacctactctgactcaatactcgccggactccctgcagcagataaaaaggtcctcgaagacgcggaaaacgatccatccatcccagtcggtgctccacttttccttgaaggactccacggatctgatcttacaatcgacacgacctcagcttcaggactgatcaaagtcacatccccagctatcaacctcagtccaaatccaaaatctccacgccgttccactccaggtacaaagagtccagttgtgttgagtccacgtcaagagcactcaatggaagtattgatcgcaacaaagcgaggaaaacctggattcttgccaccaggagaacttgctgaagatattgatgatgaggatgcatttatggatgacagaaagaaacaagtgaaaccaaaggatcatgatggagaaaatgatttcaaagatgagaaagaaagactggagaaggacaaaaacagaagaactgttaacttggatgatcttgataaatatcgtccaagtgcattctacaaagatgatagtgatttcggacatcctggatatgatattgatgcaactccatgggactcacattatcagattggtccagacacttatctgatggctgctcgtggagccgccttcaactcccgagtccgtaactatcgtgaggaactcttcggaatgggggctccaactgtcaaacagggattcctcggagtcagaaatcgtgacattactgttcgtgaacgtcgtcgttacactgatatcctccgcgagactacacaaggccttgagccaaaatctcatgagcaatcaacagctcttcttcaaaaagctccatcagcaacagcaattgagagaattaaggctgatattgagaaggtcacgccgtgtgccacaaagaagaatgatgatggaacctttgccccaatcttcactgcccgtctccgtgatgtgtatcttcgtaaaaaccaaccagcaattttcgaatgcgctgtttcagccagcccggctccaaaagttacttgggacttccaagggaagattctagagtctaacgacagggttacaatcgaacaagataacaatgtcgcccgtcttatccttaaccatgcagctccttacgatcttggagaatacgtgtgcactgccataaatgaatatggaacagataaatcaagttgccgactgataagtggagagactccatctcgtccaggaagacctgaagctgaactctcatctgatacggagattttcattcaatgggaagctccagaaggaccaacatatctggaaggtatcacctacagactcgaatatcgtgttgcaggaccgaatgatcatggtgacccatggatcactgtttctgaaaagattgatgatgaatctgtaattgttaaacatctatcaccacttggaatttatcaattccgagtcactgcacagaatggattcggtctagggctcccatcattgagtagcagaattgttcaaactcacggaaaaggagcaccaaagttgcaaattgatgttttgaaatccgagattcgactgaatgttgtttcaatgcctcaaaagtctacaaatcaattaggaggaatttcggaggaaagtgaagaggattcggaggcaagaacggcaaatgaagatatgaaatcaaatctgcaattgcaaactgatgatccaacaggacggttccagatcggtggtctcaagttcaagggacgtttctctgtgatccgcgacgccgtcgattccacaacagaaggtcacgcccattgcgctgtgaagattcgtcatccatcgtctgaagcgatctcagagtatgaatcgcttcgtgatggtcagcatgaaaatgttcaacgccttatcgccgcattcaataactccaatttcttgtatctattatcggaaagactctacgaagatgtgttttctcgttttgtgttcaacgattattatacagaagaacaagttgcattgacaatgagacaagtcacttcggcacttcatttcttgcatttcaaaggaattgcccatcttgatgtgaatccacacaacataatgttccaatcaaaacgtagttgggtcgtgaaactagttgattttggaagagcacaaaaagtgtcgggagctgtgaaaccagttgattttgatactaaatgggcttcaccagaattccatattccggaaactccggttaccgttcaaagtgacatgtggggtatgggagtcgtcactttctgccttctcgctggattccacccgttcacttctgaatacgaccgcgaagaggagatcaaggagaacgtgatcaatgtgaaatgtgatccaaatttgattccagtcaacgcttcccaagaatgcctttcatttgccacgtgggcgctcaaaaagtcgccagttcgccgaatgagaaccgacgaggctctttctcataagttcctttcttcagatccatcgatggttagaaggagggaatctattaaatactctgcatcaagactccgaaagcttgccgcaatgatccgccagccaacattcagccaaccaatcagcgaagagctcgagtcgaaatatggaaaataa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]