2024-09-28 09:30:27, GGRNA.v2 : RefSeq release 225 (Jul, 2024)
LOCUS NM_001330896 1023 bp mRNA linear INV 11-JUN-2024 DEFINITION Caenorhabditis elegans Sex determination protein fox-1 (fox-1), partial mRNA. ACCESSION NM_001330896 VERSION NM_001330896.3 DBLINK BioProject: PRJNA158 KEYWORDS RefSeq. SOURCE Caenorhabditis elegans ORGANISM Caenorhabditis elegans Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis. REFERENCE 1 (bases 1 to 1023) AUTHORS Sulson,J.E. and Waterston,R. CONSRTM Caenorhabditis elegans Sequencing Consortium TITLE Genome sequence of the nematode C. elegans: a platform for investigating biology JOURNAL Science 282 (5396), 2012-2018 (1998) PUBMED 9851916 REMARK Erratum:[Science 1999 Jan 1;283(5398):35] REFERENCE 2 (bases 1 to 1023) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (11-JUN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 1023) AUTHORS WormBase. CONSRTM WormBase Consortium TITLE Direct Submission JOURNAL Submitted (23-MAY-2024) WormBase Group, European Bioinformatics Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org REFERENCE 4 (bases 1 to 1023) AUTHORS Sulson,J.E. and Waterston,R. TITLE Direct Submission JOURNAL Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute at Washington University, St. Louis, MO 63110, USA COMMENT REVIEWED REFSEQ: This record has been curated by WormBase. This record is derived from an annotated genomic sequence (NC_003284). On Apr 15, 2020 this sequence version replaced NM_001330896.2. COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..1023 /organism="Caenorhabditis elegans" /mol_type="mRNA" /strain="Bristol N2" /db_xref="taxon:6239" /chromosome="X" gene <1..>1023 /gene="fox-1" /locus_tag="CELE_T07D1.4" /db_xref="GeneID:180549" CDS 1..1023 /gene="fox-1" /locus_tag="CELE_T07D1.4" /standard_name="T07D1.4b" /note="Confirmed by transcript evidence" /codon_start=1 /product="Sex determination protein fox-1" /protein_id="NP_001317861.1" /db_xref="GeneID:180549" /translation="
MLATSAPSLINHMENSTDGKVKDDPNSDYDLQLSIQQQLAAAAQAAQMGQTQIGPQIVGQQGQPVVATTAGSTNGSAAVTQPDPSTSSGPDGPKRLHVSNIPFRFRDPDLKTMFEKFGVVSDVEIIFNERGSKGFGFVTMERPQDAERARQELHGSMIEGRKIEVNCATARVHSKKVKPTGGILDQMNPLMAQSALAAQAQMNRALLLRSPLVAQSLLGRGAALIPGMQQPAFQLQAALAGNPLAQLQGQPLLFNAAALQTNALQQSAFGMDPAAVQAALLANEQARFQLAAAAAQGRIPSSGNASAFGEQYLSNALATASLPSYQMNPALRTLNRFTPY"
misc_feature 280..507 /gene="fox-1" /locus_tag="CELE_T07D1.4" /note="RNA recognition motif (RRM) found in vertebrate RNA binding protein fox-1 homologs and similar proteins; Region: RRM_FOX1_like; cd12407" /db_xref="CDD:409841" misc_feature order(283..285,289..291,295..312,370..384,388..405, 409..411,481..483,496..507) /gene="fox-1" /locus_tag="CELE_T07D1.4" /note="RNA binding site [nucleotide binding]; other site" /db_xref="CDD:409841" misc_feature <286..984 /gene="fox-1" /locus_tag="CELE_T07D1.4" /note="polyadenylate binding protein, human types 1, 2, 3, 4 family; Region: PABP-1234; TIGR01628" /db_xref="CDD:130689" ORIGIN
atgcttgctaccagcgctccatcattgattaatcatatggagaactcgacggacggtaaagtcaaggacgatccgaacagtgattacgatttgcaactctcgattcagcaacaattggcggcggcagcgcaagctgctcagatgggacaaacgcagattggtccacaaattgtgggacaacaagggcagccggtagtcgccacaacggccggttcgacgaatggctcggcggccgtcacacagcccgatcccagcactagctccggacccgatggaccaaaaagacttcacgtatcgaatatcccattcagattcagagacccagacctcaaaacgatgtttgagaaatttggtgtggtttccgacgtagaaattattttcaatgagcgaggatcaaaggggtttggatttgtgacaatggagagaccgcaggatgctgagagagctagacaagagcttcatggatcaatgattgaaggacggaaaattgaagtcaactgcgctacagctcgtgttcactcgaagaaagttaaaccaactggaggaatcctggaccaaatgaacccactgatggcccaatcagctcttgccgcacaggctcagatgaacagagccctattgctccgtagtccattggtagcacaatctcttcttggtcgcggagccgctttaatccccggaatgcaacagcccgcgttccaattgcaagcggctttggctggcaatccgctggcacaacttcaaggtcaacctttgctgttcaacgctgcagcccttcaaacgaacgcactccaacagtcggcgtttggaatggatccggccgccgttcaagctgctctgcttgccaatgagcaagctcggtttcaactcgctgctgccgctgctcaaggacggatcccatcatctggaaatgcctcggcgtttggcgaacaataccttagcaacgcgttggccaccgcctcactcccctcatatcaaatgaacccggcgcttagaacgttaaatcgatttactccgtattga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]