2024-09-28 09:24:05, GGRNA.v2 : RefSeq release 225 (Jul, 2024)
LOCUS NM_104576 2419 bp mRNA linear PLN 20-OCT-2022 DEFINITION Arabidopsis thaliana Zinc finger (C3HC4-type RING finger) family protein (VIM1), mRNA. ACCESSION NM_104576 VERSION NM_104576.6 DBLINK BioProject: PRJNA116 BioSample: SAMN03081427 KEYWORDS RefSeq. SOURCE Arabidopsis thaliana (thale cress) ORGANISM Arabidopsis thaliana Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis. REFERENCE 1 (bases 1 to 2419) AUTHORS Theologis,A., Ecker,J.R., Palm,C.J., Federspiel,N.A., Kaul,S., White,O., Alonso,J., Altafi,H., Araujo,R., Bowman,C.L., Brooks,S.Y., Buehler,E., Chan,A., Chao,Q., Chen,H., Cheuk,R.F., Chin,C.W., Chung,M.K., Conn,L., Conway,A.B., Conway,A.R., Creasy,T.H., Dewar,K., Dunn,P., Etgu,P., Feldblyum,T.V., Feng,J., Fong,B., Fujii,C.Y., Gill,J.E., Goldsmith,A.D., Haas,B., Hansen,N.F., Hughes,B., Huizar,L., Hunter,J.L., Jenkins,J., Johnson-Hopson,C., Khan,S., Khaykin,E., Kim,C.J., Koo,H.L., Kremenetskaia,I., Kurtz,D.B., Kwan,A., Lam,B., Langin-Hooper,S., Lee,A., Lee,J.M., Lenz,C.A., Li,J.H., Li,Y., Lin,X., Liu,S.X., Liu,Z.A., Luros,J.S., Maiti,R., Marziali,A., Militscher,J., Miranda,M., Nguyen,M., Nierman,W.C., Osborne,B.I., Pai,G., Peterson,J., Pham,P.K., Rizzo,M., Rooney,T., Rowley,D., Sakano,H., Salzberg,S.L., Schwartz,J.R., Shinn,P., Southwick,A.M., Sun,H., Tallon,L.J., Tambunga,G., Toriumi,M.J., Town,C.D., Utterback,T., Van Aken,S., Vaysberg,M., Vysotskaia,V.S., Walker,M., Wu,D., Yu,G., Fraser,C.M., Venter,J.C. and Davis,R.W. TITLE Sequence and analysis of chromosome 1 of the plant Arabidopsis thaliana JOURNAL Nature 408 (6814), 816-820 (2000) PUBMED 11130712 REFERENCE 2 (bases 1 to 2419) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (19-OCT-2022) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 2419) AUTHORS Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M., Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R., Vaughn,M. and Town,C.D. TITLE Direct Submission JOURNAL Submitted (18-JUL-2017) Plant Genomics, J. Craig Venter Institute, 9704 Medical Center Dr, Rockville, MD 20850, USA REMARK Protein update by submitter REFERENCE 4 (bases 1 to 2419) AUTHORS Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M., Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R., Vaughn,M. and Town,C.D. TITLE Direct Submission JOURNAL Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute, 9704 Medical Center Dr, Rockville, MD 20850, USA REMARK Protein update by submitter REFERENCE 5 (bases 1 to 2419) AUTHORS Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E. CONSRTM TAIR TITLE Direct Submission JOURNAL Submitted (18-FEB-2011) Department of Plant Biology, Carnegie Institution, 260 Panama Street, Stanford, CA, USA COMMENT REVIEWED REFSEQ: This record has been curated by TAIR and Araport. This record is derived from an annotated genomic sequence (NC_003070). On Sep 12, 2016 this sequence version replaced NM_104576.5. FEATURES Location/Qualifiers source 1..2419 /organism="Arabidopsis thaliana" /mol_type="mRNA" /db_xref="taxon:3702" /chromosome="1" /ecotype="Columbia" gene 1..2419 /gene="VIM1" /locus_tag="AT1G57820" /gene_synonym="F12K22.14; F12K22_14; ORTH2; ORTHRUS 2; VARIANT IN METHYLATION 1" /note="Encodes a 645-amino acid methylcytosine-binding protein with a PHD domain, two RING finger domains, and an SRA domain that is involved in centromere heterochromatinization. This protein functions as an E3 ubiquitin ligase in vitro. The protein has been shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the former. It plays a role in the establishment/maintenance of chromatin structure during cell division and is localized in the nucleus. Plants over-expressing VIM1/ORTH2 show an inhibition in root growth and a delay in flowering. Both over-expression of GFP:ORTH2 and loss of ORTH2/VIM1 lead to decreased levels of DNA methylation. GFP:ORTH2 over-expressers also have increased levels of FWA transcripts." /db_xref="Araport:AT1G57820" /db_xref="GeneID:842157" /db_xref="TAIR:AT1G57820" CDS 214..2151 /gene="VIM1" /locus_tag="AT1G57820" /gene_synonym="F12K22.14; F12K22_14; ORTH2; ORTHRUS 2; VARIANT IN METHYLATION 1" /codon_start=1 /product="Zinc finger (C3HC4-type RING finger) family protein" /protein_id="NP_176092.2" /db_xref="Araport:AT1G57820" /db_xref="GeneID:842157" /db_xref="TAIR:AT1G57820" /translation="
MARDIQLPCDGDGVCMRCKSNPPPEESLTCGTCVTPWHVSCLSSPPKTLASTLQWHCPDCSGEIDPLPVSGGATGFESAGSDLVAAIRAIEADESLSTEEKAKMRQRLLSGKGVEEDDEEEKRKKKGKGKNPNLDVLSALGDNLMCSFCMQLPERPVTKPCGHNACLKCFEKWMGQGKRTCGKCRSIIPEKMAKNPRINSSLVAAIRLAKVSKSAAATTSKVFHFISNQDRPDKAFTTERAKKTGKANAASGKIYVTIPPDHFGPIPAENDPVRNQGLLVGESWEDRLECRQWGAHFPHVAGIAGQSTYGAQSVALSGGYKDDEDHGEWFLYTGSGGRDLSGNKRTNKEQSFDQKFEKSNAALKLSCKLGYPVRVVRSHKEKRSAYAPEEGVRYDGVYRIEKCWRKVGVQGSFKVCRYLFVRCDNEPAPWTSDENGDRPRPIPNIPELNMATDLFERKETPSWDFDEGEGCWKWMKPPPASKKSVNVLAPEERKNLRKAIKAAHSNTMRARLLKEFKCQICQQVLTLPVTTPCAHNFCKACLEAKFAGKTLVRERSTGGRTLRSRKNVLNCPCCPTDISDFLQNPQVNREVAEVIEKLKTQEEDTAELEDEDEGECSGTTPEEDSEQPKKRIKLDTDATVSATIR"
misc_feature 253..393 /gene="VIM1" /locus_tag="AT1G57820" /gene_synonym="F12K22.14; F12K22_14; ORTH2; ORTHRUS 2; VARIANT IN METHYLATION 1" /note="PHD zinc finger; Region: PHD; smart00249" /db_xref="CDD:214584" misc_feature order(292..303,313..315,376..378) /gene="VIM1" /locus_tag="AT1G57820" /gene_synonym="F12K22.14; F12K22_14; ORTH2; ORTHRUS 2; VARIANT IN METHYLATION 1" /note="histone H3 binding site [polypeptide binding]; other site" /db_xref="CDD:276966" misc_feature 637..780 /gene="VIM1" /locus_tag="AT1G57820" /gene_synonym="F12K22.14; F12K22_14; ORTH2; ORTHRUS 2; VARIANT IN METHYLATION 1" /note="first RING finger, HC subclass, found in Arabidopsis thaliana ORTHRUS and similar proteins; Region: RING-HC_ORTHRUS_rpt1; cd23138" /db_xref="CDD:438500" misc_feature 997..1485 /gene="VIM1" /locus_tag="AT1G57820" /gene_synonym="F12K22.14; F12K22_14; ORTH2; ORTHRUS 2; VARIANT IN METHYLATION 1" /note="SAD/SRA domain; Region: SAD_SRA; pfam02182" /db_xref="CDD:460476" misc_feature 1744..1959 /gene="VIM1" /locus_tag="AT1G57820" /gene_synonym="F12K22.14; F12K22_14; ORTH2; ORTHRUS 2; VARIANT IN METHYLATION 1" /note="second RING finger, HC subclass, found in Arabidopsis thaliana ORTHRUS and similar proteins; Region: RING-HC_ORTHRUS_rpt2; cd23139" /db_xref="CDD:438501" ORIGIN
acaagacaacacatagccaaaaaaatcttttgggtatcgttttgaatttcaaagacgctctcgtcctttcccaaaatatttcaaacacccgcctcttcagtatttcgtttcccactctttttattcccaattctctagaaccttcctctctctccatctctcaaaatctcggaaacaccattttctcactctctgatcttttttcccccaaaaatggcgcgtgacatccaactcccctgcgacggcgacggcgtatgcatgcgatgcaaatccaaccctccgcctgaagaatctctcacttgcggcacgtgcgttacaccgtggcacgtgtcctgtctctcttcacctcccaaaaccctagcttccactctacagtggcattgtcctgattgctccggcgaaatcgatcctcttcctgtttccggcggtgctactggtttcgaatctgctgggtcagatcttgtagctgcgattcgtgcgattgaggctgatgagtcgttgagtactgaagagaaagctaagatgaggcaacggttactgagtggtaaaggtgttgaggaggatgatgaagaagagaagaggaagaagaaggggaaagggaagaatccgaatctggatgtgttatctgctcttggagataacttgatgtgttctttctgtatgcagttgcctgagagacctgtgacgaaaccatgtgggcacaacgcttgcttaaaatgttttgagaaatggatggggcagggaaagagaacttgtggtaaatgccgcagcataattcctgaaaaaatggctaagaatccccgtatcaactcgtctcttgttgctgccattcgattagcaaaagtctctaaaagtgctgctgcgaccacttcaaaggtctttcatttcatcagcaaccaagaccgaccagataaagcatttacaaccgagcgtgcaaagaaaactggcaaggcaaacgctgctagtggaaagatttatgttacaataccaccagatcattttggtcctattccagctgaaaatgaccctgtcaggaaccaaggtcttttggttggagaatcctgggaggacagactcgagtgtaggcagtggggtgctcatttcccacatgttgctggcattgctggacaatctacttatggcgctcaatctgtagcactctctggaggttataaggatgatgaggatcatggagaatggtttctatacacaggaagtgggggtagagatctcagtggcaacaaaaggactaacaaggagcagtcttttgaccaaaagtttgagaagtctaatgcagcattaaaactcagctgcaaattggggtatcctgttcgagttgtcaggtctcacaaggagaagcgttctgcatacgcccctgaggaaggagtgagatatgatggggtttacaggattgagaagtgctggcgcaaagttggagtacagggttcttttaaggtctgtcgttacctgttcgttagatgtgacaatgagccagctccatggaccagtgatgagaatggagatcgtccaagacctatccctaatattccagagcttaatatggccaccgacctgtttgagagaaaagaaactccatcatgggattttgatgaaggtgagggttgttggaaatggatgaagccgccacctgcaagtaaaaagtcagtgaatgttttggctcctgaggagaggaaaaatttgaggaaagccataaaggcggcacactcgaataccatgagggcaagacttctgaaagaatttaagtgccagatctgtcagcaagtgttgactcttcctgtgacaacaccctgtgctcataacttctgcaaggcttgcttagaagcgaaatttgctgggaaaactcttgtgagagagagaagcacaggtggacggacactacgctcaaggaagaatgtcctgaactgcccttgttgcccaacagacatatctgattttctgcagaaccctcaggtcaacagagaagtagcggaggtgatagagaagctaaagacccaggaagaggacaccgcagagcttgaagatgaagatgaaggtgaatgctcaggcaccacccctgaagaagattctgagcaaccgaagaaaaggatcaagttggacactgacgcaacagtttctgcgaccatcaggtgaagttggtaccaaagaactctttagtaaaaaaaaactctagtgccttattttgtacgcaatatttgtggaacgtacctattgcgatgtgttattttggatcttacaacaactaagttattaatatggaacgtaaactatggttctcaggttttcaatttttctcttattttggtgtctctggtttataactcggataggttggttttgataataccatcaggtactaagcagtgaattctcaatttagtatagaatggatgttgtttca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]