2024-09-28 09:26:08, GGRNA.v2 : RefSeq release 225 (Jul, 2024)
LOCUS NM_001333805 2119 bp mRNA linear PLN 20-OCT-2022 DEFINITION Arabidopsis thaliana zinc finger (C3HC4-type RING finger) family protein (VIM5), partial mRNA. ACCESSION NM_001333805 VERSION NM_001333805.1 DBLINK BioProject: PRJNA116 BioSample: SAMN03081427 KEYWORDS RefSeq. SOURCE Arabidopsis thaliana (thale cress) ORGANISM Arabidopsis thaliana Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis. REFERENCE 1 (bases 1 to 2119) AUTHORS Theologis,A., Ecker,J.R., Palm,C.J., Federspiel,N.A., Kaul,S., White,O., Alonso,J., Altafi,H., Araujo,R., Bowman,C.L., Brooks,S.Y., Buehler,E., Chan,A., Chao,Q., Chen,H., Cheuk,R.F., Chin,C.W., Chung,M.K., Conn,L., Conway,A.B., Conway,A.R., Creasy,T.H., Dewar,K., Dunn,P., Etgu,P., Feldblyum,T.V., Feng,J., Fong,B., Fujii,C.Y., Gill,J.E., Goldsmith,A.D., Haas,B., Hansen,N.F., Hughes,B., Huizar,L., Hunter,J.L., Jenkins,J., Johnson-Hopson,C., Khan,S., Khaykin,E., Kim,C.J., Koo,H.L., Kremenetskaia,I., Kurtz,D.B., Kwan,A., Lam,B., Langin-Hooper,S., Lee,A., Lee,J.M., Lenz,C.A., Li,J.H., Li,Y., Lin,X., Liu,S.X., Liu,Z.A., Luros,J.S., Maiti,R., Marziali,A., Militscher,J., Miranda,M., Nguyen,M., Nierman,W.C., Osborne,B.I., Pai,G., Peterson,J., Pham,P.K., Rizzo,M., Rooney,T., Rowley,D., Sakano,H., Salzberg,S.L., Schwartz,J.R., Shinn,P., Southwick,A.M., Sun,H., Tallon,L.J., Tambunga,G., Toriumi,M.J., Town,C.D., Utterback,T., Van Aken,S., Vaysberg,M., Vysotskaia,V.S., Walker,M., Wu,D., Yu,G., Fraser,C.M., Venter,J.C. and Davis,R.W. TITLE Sequence and analysis of chromosome 1 of the plant Arabidopsis thaliana JOURNAL Nature 408 (6814), 816-820 (2000) PUBMED 11130712 REFERENCE 2 (bases 1 to 2119) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (19-OCT-2022) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 2119) AUTHORS Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M., Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R., Vaughn,M. and Town,C.D. TITLE Direct Submission JOURNAL Submitted (18-JUL-2017) Plant Genomics, J. Craig Venter Institute, 9704 Medical Center Dr, Rockville, MD 20850, USA REMARK Protein update by submitter REFERENCE 4 (bases 1 to 2119) AUTHORS Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M., Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R., Vaughn,M. and Town,C.D. TITLE Direct Submission JOURNAL Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute, 9704 Medical Center Dr, Rockville, MD 20850, USA REMARK Protein update by submitter REFERENCE 5 (bases 1 to 2119) AUTHORS Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E. CONSRTM TAIR TITLE Direct Submission JOURNAL Submitted (18-FEB-2011) Department of Plant Biology, Carnegie Institution, 260 Panama Street, Stanford, CA, USA COMMENT REVIEWED REFSEQ: This record has been curated by TAIR and Araport. This record is derived from an annotated genomic sequence (NC_003070). COMPLETENESS: incomplete on the 5' end. FEATURES Location/Qualifiers source 1..2119 /organism="Arabidopsis thaliana" /mol_type="mRNA" /db_xref="taxon:3702" /chromosome="1" /ecotype="Columbia" gene <1..2119 /gene="VIM5" /locus_tag="AT1G57800" /gene_synonym="F12K22.15; F12K22_15; ORTH3; ORTHRUS 3; VARIANT IN METHYLATION 5" /note="predicted to encode a protein with an N-terminal PHD domain and two RING domains surrounding an SRA domain. Attempts to isolate ORTH3/VIM5 cDNA through RT-PCR were unsuccessful and only one Arabidopsis EST is associated with this locus. A paternally expressed imprinted gene." /db_xref="Araport:AT1G57800" /db_xref="GeneID:842155" /db_xref="TAIR:AT1G57800" CDS 1..1995 /gene="VIM5" /locus_tag="AT1G57800" /gene_synonym="F12K22.15; F12K22_15; ORTH3; ORTHRUS 3; VARIANT IN METHYLATION 5" /codon_start=1 /product="zinc finger (C3HC4-type RING finger) family protein" /protein_id="NP_001321213.1" /db_xref="Araport:AT1G57800" /db_xref="GeneID:842155" /db_xref="TAIR:AT1G57800" /translation="
MTPATQYPCDPEGVCMRCKSMPPPEESLTCGTCVTPWHVSCLLSPPETLSATLQWLCPDCSGETNPLPVSGVAAGYGSVGSDLVAAIHSIEADETLSAEEKAKKKQQLLSGKGVVDEDDEEEKKKTSKGKKPIDVLSHFECSFCMQSLQKPVSVRVLFALALMLVWFLESTPCGHNACLKCFLKWMGQGHRSCGTCRSVIPESMVTNPRINLSIVSAIRLARVSEKADARTSKVVHYVDNEDRPDKAFTTERAKKTGNANASSGKIFVTIPRDHFGPIPAENDPVRNQGLLVGESWKGRLACRQWGAHFPHVSGIAGQASYGAQSVVLAGGYDDDEDHGEWFLYTGSGGRILKGNKRTNTVQAFDQVFLNFNEALRLSCKLGYPVRVVRSTKDKRSPYAPQGGLLRYDGVYRIEKCWRIVGIQGTHKMCRFLFVRCDNEPAPWTSDEHGDRPRPLPNVPELNMATDLFERKESPSWDFDEGEDRWRWMKPPPASKKAVKNVLDPEERKLLREAIKSANPNTMRARLLKEFKCQICQKVMTNPVTTPCAHNFCKACLESKFAGTALVRERGSGGRKLRSQKSVMKCPCCPTDIAEFVQNPQVNREVAEVIEKLKKQEEEENAKSLDEGQCSGTSHEEEDDEQPKKRIKLDTDAEVSATVVESDMK"
misc_feature 40..180 /gene="VIM5" /locus_tag="AT1G57800" /gene_synonym="F12K22.15; F12K22_15; ORTH3; ORTHRUS 3; VARIANT IN METHYLATION 5" /note="PHD zinc finger; Region: PHD; smart00249" /db_xref="CDD:214584" misc_feature order(79..90,100..102,163..165) /gene="VIM5" /locus_tag="AT1G57800" /gene_synonym="F12K22.15; F12K22_15; ORTH3; ORTHRUS 3; VARIANT IN METHYLATION 5" /note="histone H3 binding site [polypeptide binding]; other site" /db_xref="CDD:276966" misc_feature 409..603 /gene="VIM5" /locus_tag="AT1G57800" /gene_synonym="F12K22.15; F12K22_15; ORTH3; ORTHRUS 3; VARIANT IN METHYLATION 5" /note="RING finger (Really Interesting New Gene) domain and U-box domain superfamily; Region: RING_Ubox; cl17238" /db_xref="CDD:473075" misc_feature order(421..423,430..432,517..519,523..525,532..534, 541..543,577..579,586..588) /gene="VIM5" /locus_tag="AT1G57800" /gene_synonym="F12K22.15; F12K22_15; ORTH3; ORTHRUS 3; VARIANT IN METHYLATION 5" /note="cross-brace motif; other site" /db_xref="CDD:438500" misc_feature 820..1311 /gene="VIM5" /locus_tag="AT1G57800" /gene_synonym="F12K22.15; F12K22_15; ORTH3; ORTHRUS 3; VARIANT IN METHYLATION 5" /note="SAD/SRA domain; Region: SAD_SRA; pfam02182" /db_xref="CDD:460476" misc_feature 1573..1788 /gene="VIM5" /locus_tag="AT1G57800" /gene_synonym="F12K22.15; F12K22_15; ORTH3; ORTHRUS 3; VARIANT IN METHYLATION 5" /note="second RING finger, HC subclass, found in Arabidopsis thaliana ORTHRUS and similar proteins; Region: RING-HC_ORTHRUS_rpt2; cd23139" /db_xref="CDD:438501" ORIGIN
atgacgcctgccacccagtacccatgcgaccccgaaggtgtatgcatgcgatgcaaatcgatgcctccaccggaggaatctctcacttgcggcacgtgcgtcacgccttggcacgtgtcctgccttttgtccccgcccgaaaccctaagtgctactttacagtggctttgtcctgattgctccggtgaaaccaatcctcttcctgtttccggtgttgcggctggatatggatctgttggttcagatcttgtagcggcgatccactcgattgaggcggatgaaactctctctgctgaagagaaggctaagaagaagcagcagttactgagtggtaagggggtcgtcgatgaggatgacgaagaagagaagaagaagacgagtaaaggaaagaaacccatcgatgtgctatctcacttcgagtgttctttctgcatgcagtcgctacaaaaacccgtctcggttcgtgtactctttgctttggctcttatgcttgtgtggtttctcgaatctacaccatgtgggcacaacgcttgcttgaaatgtttcttgaagtggatggggcagggacaccgcagttgtggaacatgccgcagcgtaattcctgaaagcatggttaccaatccccgtatcaacttgtccattgtgtctgctattaggttagcaagagtatccgaaaaggctgatgcgcgtacttcaaaagttgttcactatgttgacaatgaagatcgtccagataaagcatttacaactgagcgcgctaagaaaacagggaatgcaaatgcttccagtggcaagatttttgttacaatccctcgagatcattttggtcctataccagctgaaaatgatcctgttaggaaccaaggtcttttggttggagaatcctggaagggccgacttgcttgtcggcagtggggggctcacttcccacatgtttccggcattgctggacaagcgagttatggagctcaatctgttgtgctcgctggaggttatgatgatgatgaggatcatggagaatggtttctatacacaggaagtgggggaagaattctcaaaggcaacaaaaggactaacacggttcaagcttttgatcaagtatttctaaactttaatgaagctttaagacttagttgtaaactagggtatcctgttcgagttgtcaggtctaccaaggacaagcgttctccatacgcccctcaaggaggactactaaggtatgatggtgtttaccggatagagaaatgctggaggatagttggaatacagggcactcataagatgtgccgtttcctgtttgttagatgtgacaatgagccagctccatggaccagtgatgagcatggagatcgcccaagacctttgcctaatgttcctgagcttaatatggccacagacctgtttgagagaaaagaaagtccatcatgggattttgatgaaggtgaggatcgttggagatggatgaagccaccacctgctagtaaaaaggcagttaaaaatgttttggatcctgaggagaggaaacttttgagggaagccataaagtcggcaaacccgaataccatgagggcaagacttttgaaagaatttaagtgccagatctgtcagaaagtgatgactaatcctgtgacaacgccttgtgctcataacttctgcaaggcttgtttggaatcgaagtttgctgggacagctctagtgagagagagaggcagcggtggacgaaaattacgttcacaaaagagtgtcatgaagtgcccttgttgcccaacggacattgccgagtttgtccagaaccctcaggtcaatagagaagtagcggaggtgatagagaagctgaagaaacaggaagaggaggaaaacgcaaagtctttagatgaaggtcaatgctcaggtaccagccatgaagaagaagatgatgagcaaccaaagaaacggattaagttggacactgacgcagaagtttctgcgactgttgtggaatctgacatgaagtaagtaagtaggggcctttccaatggctcttttggacaagtaaacttggagactatgtttatgttttggtaccaaagactggaaaaactctcttaccttatttagtacgcaacatttgtggaacgta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]