GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-09-28 09:26:08, GGRNA.v2 : RefSeq release 225 (Jul, 2024)

LOCUS       NM_001333805            2119 bp    mRNA    linear   PLN 20-OCT-2022
DEFINITION  Arabidopsis thaliana zinc finger (C3HC4-type RING finger) family
            protein (VIM5), partial mRNA.
ACCESSION   NM_001333805
VERSION     NM_001333805.1
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 2119)
  AUTHORS   Theologis,A., Ecker,J.R., Palm,C.J., Federspiel,N.A., Kaul,S.,
            White,O., Alonso,J., Altafi,H., Araujo,R., Bowman,C.L.,
            Brooks,S.Y., Buehler,E., Chan,A., Chao,Q., Chen,H., Cheuk,R.F.,
            Chin,C.W., Chung,M.K., Conn,L., Conway,A.B., Conway,A.R.,
            Creasy,T.H., Dewar,K., Dunn,P., Etgu,P., Feldblyum,T.V., Feng,J.,
            Fong,B., Fujii,C.Y., Gill,J.E., Goldsmith,A.D., Haas,B.,
            Hansen,N.F., Hughes,B., Huizar,L., Hunter,J.L., Jenkins,J.,
            Johnson-Hopson,C., Khan,S., Khaykin,E., Kim,C.J., Koo,H.L.,
            Kremenetskaia,I., Kurtz,D.B., Kwan,A., Lam,B., Langin-Hooper,S.,
            Lee,A., Lee,J.M., Lenz,C.A., Li,J.H., Li,Y., Lin,X., Liu,S.X.,
            Liu,Z.A., Luros,J.S., Maiti,R., Marziali,A., Militscher,J.,
            Miranda,M., Nguyen,M., Nierman,W.C., Osborne,B.I., Pai,G.,
            Peterson,J., Pham,P.K., Rizzo,M., Rooney,T., Rowley,D., Sakano,H.,
            Salzberg,S.L., Schwartz,J.R., Shinn,P., Southwick,A.M., Sun,H.,
            Tallon,L.J., Tambunga,G., Toriumi,M.J., Town,C.D., Utterback,T.,
            Van Aken,S., Vaysberg,M., Vysotskaia,V.S., Walker,M., Wu,D., Yu,G.,
            Fraser,C.M., Venter,J.C. and Davis,R.W.
  TITLE     Sequence and analysis of chromosome 1 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 408 (6814), 816-820 (2000)
   PUBMED   11130712
REFERENCE   2  (bases 1 to 2119)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (19-OCT-2022) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 2119)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-JUL-2017) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 2119)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   5  (bases 1 to 2119)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003070).
            COMPLETENESS: incomplete on the 5' end.
FEATURES             Location/Qualifiers
     source          1..2119
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="1"
                     /ecotype="Columbia"
     gene            <1..2119
                     /gene="VIM5"
                     /locus_tag="AT1G57800"
                     /gene_synonym="F12K22.15; F12K22_15; ORTH3; ORTHRUS 3;
                     VARIANT IN METHYLATION 5"
                     /note="predicted to encode a protein with an N-terminal
                     PHD domain and two RING domains surrounding an SRA domain.
                     Attempts to isolate ORTH3/VIM5 cDNA through RT-PCR were
                     unsuccessful and only one Arabidopsis EST is associated
                     with this locus. A paternally expressed imprinted gene."
                     /db_xref="Araport:AT1G57800"
                     /db_xref="GeneID:842155"
                     /db_xref="TAIR:AT1G57800"
     CDS             1..1995
                     /gene="VIM5"
                     /locus_tag="AT1G57800"
                     /gene_synonym="F12K22.15; F12K22_15; ORTH3; ORTHRUS 3;
                     VARIANT IN METHYLATION 5"
                     /codon_start=1
                     /product="zinc finger (C3HC4-type RING finger) family
                     protein"
                     /protein_id="NP_001321213.1"
                     /db_xref="Araport:AT1G57800"
                     /db_xref="GeneID:842155"
                     /db_xref="TAIR:AT1G57800"
                     /translation="
MTPATQYPCDPEGVCMRCKSMPPPEESLTCGTCVTPWHVSCLLSPPETLSATLQWLCPDCSGETNPLPVSGVAAGYGSVGSDLVAAIHSIEADETLSAEEKAKKKQQLLSGKGVVDEDDEEEKKKTSKGKKPIDVLSHFECSFCMQSLQKPVSVRVLFALALMLVWFLESTPCGHNACLKCFLKWMGQGHRSCGTCRSVIPESMVTNPRINLSIVSAIRLARVSEKADARTSKVVHYVDNEDRPDKAFTTERAKKTGNANASSGKIFVTIPRDHFGPIPAENDPVRNQGLLVGESWKGRLACRQWGAHFPHVSGIAGQASYGAQSVVLAGGYDDDEDHGEWFLYTGSGGRILKGNKRTNTVQAFDQVFLNFNEALRLSCKLGYPVRVVRSTKDKRSPYAPQGGLLRYDGVYRIEKCWRIVGIQGTHKMCRFLFVRCDNEPAPWTSDEHGDRPRPLPNVPELNMATDLFERKESPSWDFDEGEDRWRWMKPPPASKKAVKNVLDPEERKLLREAIKSANPNTMRARLLKEFKCQICQKVMTNPVTTPCAHNFCKACLESKFAGTALVRERGSGGRKLRSQKSVMKCPCCPTDIAEFVQNPQVNREVAEVIEKLKKQEEEENAKSLDEGQCSGTSHEEEDDEQPKKRIKLDTDAEVSATVVESDMK"
     misc_feature    40..180
                     /gene="VIM5"
                     /locus_tag="AT1G57800"
                     /gene_synonym="F12K22.15; F12K22_15; ORTH3; ORTHRUS 3;
                     VARIANT IN METHYLATION 5"
                     /note="PHD zinc finger; Region: PHD; smart00249"
                     /db_xref="CDD:214584"
     misc_feature    order(79..90,100..102,163..165)
                     /gene="VIM5"
                     /locus_tag="AT1G57800"
                     /gene_synonym="F12K22.15; F12K22_15; ORTH3; ORTHRUS 3;
                     VARIANT IN METHYLATION 5"
                     /note="histone H3 binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:276966"
     misc_feature    409..603
                     /gene="VIM5"
                     /locus_tag="AT1G57800"
                     /gene_synonym="F12K22.15; F12K22_15; ORTH3; ORTHRUS 3;
                     VARIANT IN METHYLATION 5"
                     /note="RING finger (Really Interesting New Gene) domain
                     and U-box domain superfamily; Region: RING_Ubox; cl17238"
                     /db_xref="CDD:473075"
     misc_feature    order(421..423,430..432,517..519,523..525,532..534,
                     541..543,577..579,586..588)
                     /gene="VIM5"
                     /locus_tag="AT1G57800"
                     /gene_synonym="F12K22.15; F12K22_15; ORTH3; ORTHRUS 3;
                     VARIANT IN METHYLATION 5"
                     /note="cross-brace motif; other site"
                     /db_xref="CDD:438500"
     misc_feature    820..1311
                     /gene="VIM5"
                     /locus_tag="AT1G57800"
                     /gene_synonym="F12K22.15; F12K22_15; ORTH3; ORTHRUS 3;
                     VARIANT IN METHYLATION 5"
                     /note="SAD/SRA domain; Region: SAD_SRA; pfam02182"
                     /db_xref="CDD:460476"
     misc_feature    1573..1788
                     /gene="VIM5"
                     /locus_tag="AT1G57800"
                     /gene_synonym="F12K22.15; F12K22_15; ORTH3; ORTHRUS 3;
                     VARIANT IN METHYLATION 5"
                     /note="second RING finger, HC subclass, found in
                     Arabidopsis thaliana ORTHRUS and similar proteins; Region:
                     RING-HC_ORTHRUS_rpt2; cd23139"
                     /db_xref="CDD:438501"
ORIGIN      
atgacgcctgccacccagtacccatgcgaccccgaaggtgtatgcatgcgatgcaaatcgatgcctccaccggaggaatctctcacttgcggcacgtgcgtcacgccttggcacgtgtcctgccttttgtccccgcccgaaaccctaagtgctactttacagtggctttgtcctgattgctccggtgaaaccaatcctcttcctgtttccggtgttgcggctggatatggatctgttggttcagatcttgtagcggcgatccactcgattgaggcggatgaaactctctctgctgaagagaaggctaagaagaagcagcagttactgagtggtaagggggtcgtcgatgaggatgacgaagaagagaagaagaagacgagtaaaggaaagaaacccatcgatgtgctatctcacttcgagtgttctttctgcatgcagtcgctacaaaaacccgtctcggttcgtgtactctttgctttggctcttatgcttgtgtggtttctcgaatctacaccatgtgggcacaacgcttgcttgaaatgtttcttgaagtggatggggcagggacaccgcagttgtggaacatgccgcagcgtaattcctgaaagcatggttaccaatccccgtatcaacttgtccattgtgtctgctattaggttagcaagagtatccgaaaaggctgatgcgcgtacttcaaaagttgttcactatgttgacaatgaagatcgtccagataaagcatttacaactgagcgcgctaagaaaacagggaatgcaaatgcttccagtggcaagatttttgttacaatccctcgagatcattttggtcctataccagctgaaaatgatcctgttaggaaccaaggtcttttggttggagaatcctggaagggccgacttgcttgtcggcagtggggggctcacttcccacatgtttccggcattgctggacaagcgagttatggagctcaatctgttgtgctcgctggaggttatgatgatgatgaggatcatggagaatggtttctatacacaggaagtgggggaagaattctcaaaggcaacaaaaggactaacacggttcaagcttttgatcaagtatttctaaactttaatgaagctttaagacttagttgtaaactagggtatcctgttcgagttgtcaggtctaccaaggacaagcgttctccatacgcccctcaaggaggactactaaggtatgatggtgtttaccggatagagaaatgctggaggatagttggaatacagggcactcataagatgtgccgtttcctgtttgttagatgtgacaatgagccagctccatggaccagtgatgagcatggagatcgcccaagacctttgcctaatgttcctgagcttaatatggccacagacctgtttgagagaaaagaaagtccatcatgggattttgatgaaggtgaggatcgttggagatggatgaagccaccacctgctagtaaaaaggcagttaaaaatgttttggatcctgaggagaggaaacttttgagggaagccataaagtcggcaaacccgaataccatgagggcaagacttttgaaagaatttaagtgccagatctgtcagaaagtgatgactaatcctgtgacaacgccttgtgctcataacttctgcaaggcttgtttggaatcgaagtttgctgggacagctctagtgagagagagaggcagcggtggacgaaaattacgttcacaaaagagtgtcatgaagtgcccttgttgcccaacggacattgccgagtttgtccagaaccctcaggtcaatagagaagtagcggaggtgatagagaagctgaagaaacaggaagaggaggaaaacgcaaagtctttagatgaaggtcaatgctcaggtaccagccatgaagaagaagatgatgagcaaccaaagaaacggattaagttggacactgacgcagaagtttctgcgactgttgtggaatctgacatgaagtaagtaagtaggggcctttccaatggctcttttggacaagtaaacttggagactatgtttatgttttggtaccaaagactggaaaaactctcttaccttatttagtacgcaacatttgtggaacgta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]