ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-21 13:47:44, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XR_012488168 405 bp RNA linear MAM 03-JUN-2025
DEFINITION PREDICTED: Sminthopsis crassicaudata uncharacterized LOC141561823
(LOC141561823), ncRNA.
ACCESSION XR_012488168
VERSION XR_012488168.1
DBLINK BioProject: PRJNA1266204
KEYWORDS RefSeq.
SOURCE Sminthopsis crassicaudata (fat-tailed dunnart)
ORGANISM Sminthopsis crassicaudata
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Metatheria; Dasyuromorphia; Dasyuridae; Sminthopsis.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_133619) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Full annotation
Annotation Name :: GCF_048593235.1-RS_2025_05
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 10.4
Annotation Method :: Gnomon; cmsearch; tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 05/29/2025
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..405
/organism="Sminthopsis crassicaudata"
/mol_type="transcribed RNA"
/isolate="SCR6"
/db_xref="taxon:9301"
/chromosome="3"
/sex="female"
/tissue_type="fibroblast"
/geo_loc_name="Australia: Melbourne"
gene 1..405
/gene="LOC141561823"
/note="uncharacterized LOC141561823; Derived by automated
computational analysis using gene prediction method:
Gnomon. Supporting evidence includes similarity to: 100%
coverage of the annotated genomic feature by RNAseq
alignments, including 1 sample with support for all
annotated introns"
/db_xref="GeneID:141561823"
ncRNA 1..405
/ncRNA_class="lncRNA"
/gene="LOC141561823"
/product="uncharacterized LOC141561823"
/db_xref="GeneID:141561823"
ORIGIN
taaagttctgtttgtatagagtgtctattagaagctttgcatctgtggttagcagaccgtaacctagaactgtcactttgctggtcgatattctcctaggaaacaaaatacagaagaaattttaaatagtgacttcaaatatgatgaggacaagtctagatgaagaactcagagaaatagcccacattcaaagtggcacagaatggacctcattcaatatttccaaggtatcctggagttgttggacagcaaacaatgtatcaaacatttctcaggcctttctgaagccatcctggatctcaggaagacgaccacttttcagatggacaatggtagcattcttatgaattctcaaaagacaatctcttcttgccatataacctggaatactttagtcaccttttg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]