GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-08-29 22:28:45, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XR_011966223             233 bp    RNA     linear   MAM 26-MAR-2025
DEFINITION  PREDICTED: Notamacropus eugenii uncharacterized lncRNA
            (LOC140501541), ncRNA.
ACCESSION   XR_011966223
VERSION     XR_011966223.1
DBLINK      BioProject: PRJNA1238332
KEYWORDS    RefSeq.
SOURCE      Notamacropus eugenii (tammar wallaby)
  ORGANISM  Notamacropus eugenii
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Metatheria; Diprotodontia; Macropodidae; Notamacropus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_092872) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_028372415.1-RS_2025_03
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 03/21/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..233
                     /organism="Notamacropus eugenii"
                     /mol_type="transcribed RNA"
                     /isolate="mMacEug1"
                     /db_xref="taxon:9315"
                     /chromosome="1"
                     /sex="male"
                     /tissue_type="muscle, spleen"
                     /dev_stage="adult"
                     /geo_loc_name="New Zealand: Waimangu thermal area"
                     /lat_lon="38.279799 S 176.408000 E"
                     /collection_date="2018-02-13"
                     /collected_by="Andrew Veale"
     gene            1..233
                     /gene="LOC140501541"
                     /note="uncharacterized LOC140501541; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:140501541"
     ncRNA           1..233
                     /ncRNA_class="lncRNA"
                     /gene="LOC140501541"
                     /product="uncharacterized lncRNA"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
                     /db_xref="GeneID:140501541"
ORIGIN      
ctctggagacaaagcagcacgcagggaggtcagccaggggaattccttgcatccatcacagaacagaatgccaaacatcactgggattatcctaagagttttcaaccaaagacaagaagagattgcagaaaggaaaaacaattcaaaaggaaagatatgttacatggatttctccccatcttccattttgacaactgttacaaatgtgaaaaaatacatttccttggaaattg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]