2025-08-29 22:28:45, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XR_011966223 233 bp RNA linear MAM 26-MAR-2025 DEFINITION PREDICTED: Notamacropus eugenii uncharacterized lncRNA (LOC140501541), ncRNA. ACCESSION XR_011966223 VERSION XR_011966223.1 DBLINK BioProject: PRJNA1238332 KEYWORDS RefSeq. SOURCE Notamacropus eugenii (tammar wallaby) ORGANISM Notamacropus eugenii Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Metatheria; Diprotodontia; Macropodidae; Notamacropus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_092872) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_028372415.1-RS_2025_03 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 03/21/2025 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..233 /organism="Notamacropus eugenii" /mol_type="transcribed RNA" /isolate="mMacEug1" /db_xref="taxon:9315" /chromosome="1" /sex="male" /tissue_type="muscle, spleen" /dev_stage="adult" /geo_loc_name="New Zealand: Waimangu thermal area" /lat_lon="38.279799 S 176.408000 E" /collection_date="2018-02-13" /collected_by="Andrew Veale" gene 1..233 /gene="LOC140501541" /note="uncharacterized LOC140501541; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:140501541" ncRNA 1..233 /ncRNA_class="lncRNA" /gene="LOC140501541" /product="uncharacterized lncRNA" /experiment="COORDINATES: polyA evidence [ECO:0006239]" /db_xref="GeneID:140501541" ORIGIN
ctctggagacaaagcagcacgcagggaggtcagccaggggaattccttgcatccatcacagaacagaatgccaaacatcactgggattatcctaagagttttcaaccaaagacaagaagagattgcagaaaggaaaaacaattcaaaaggaaagatatgttacatggatttctccccatcttccattttgacaactgttacaaatgtgaaaaaatacatttccttggaaattg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]