2025-04-04 14:02:23, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XR_010720623 415 bp RNA linear VRT 01-JUL-2024 DEFINITION PREDICTED: Chamaea fasciata uncharacterized lncRNA (LOC136288878), ncRNA. ACCESSION XR_010720623 VERSION XR_010720623.1 DBLINK BioProject: PRJNA1129162 KEYWORDS RefSeq. SOURCE Chamaea fasciata ORGANISM Chamaea fasciata Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Australaves; Passeriformes; Sylvioidea; Sylviidae; Sylviidae incertae sedis; Chamaea. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_027094089) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_029207755.1-RS_2024_06 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 06/28/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..415 /organism="Chamaea fasciata" /mol_type="transcribed RNA" /isolate="MVZ Bird 193981" /specimen_voucher="MVZ:Bird:193981" /db_xref="taxon:190680" /chromosome="Unknown" /sex="female" /tissue_type="liver" /ecotype="frontalis" /geo_loc_name="USA: Cow Mountain Recreation Management Area, Mayacamas Mts., Lake Co., California" /lat_lon="39.09208 N 123.08350 W" /collection_date="2020-10-13" /collected_by="Carla Cicero" gene 1..415 /gene="LOC136288878" /note="uncharacterized LOC136288878; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:136288878" ncRNA 1..415 /ncRNA_class="lncRNA" /gene="LOC136288878" /product="uncharacterized lncRNA" /db_xref="GeneID:136288878" ORIGIN
aaagacttgcagtggagaagtacaacatctgcagagtagagatcgctgaaaagaaattccacagtaaagaacgaactcaagcagaaaggacttgtcagatttctcagcacaagactgacactcagaatgaccttcagcacaagcaggaggatgcttttgagaaaatgtctgaacagtctaaaagcacaggaagattgccagcagaaagaaaagcaagaccttgaacagcagtactgacatctccttgcagaagttcacgcaagagcacaggaatgtgaagcgcaagcgcagaacaccaggcaaaaactgtgtgaccttgaacaaatctgcatggaaacggcccaggaatacaatgctgtgagaaatacatgatcagatgctcacaaggagcactcatctctgctggcagcctgtg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]