2025-04-04 14:01:10, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XR_010609266 352 bp RNA linear VRT 07-JUN-2024 DEFINITION PREDICTED: Lathamus discolor uncharacterized LOC136006787 (LOC136006787), ncRNA. ACCESSION XR_010609266 VERSION XR_010609266.1 DBLINK BioProject: PRJNA1119999 KEYWORDS RefSeq. SOURCE Lathamus discolor (Swift parrot) ORGANISM Lathamus discolor Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Australaves; Psittaciformes; Psittacidae; Lathamus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_027069385) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_037157495.1-RS_2024_06 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 06/06/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..352 /organism="Lathamus discolor" /mol_type="transcribed RNA" /isolate="bLatDis1" /db_xref="taxon:678569" /chromosome="Unknown" /sex="female" /tissue_type="blood, muscle" /dev_stage="adult" /geo_loc_name="Australia: North Bruny, Tasmania" /lat_lon="43.164424 S 147.319128 E" /collection_date="2019-11-12" /collected_by="Manuel Schweizer" gene 1..352 /gene="LOC136006787" /note="uncharacterized LOC136006787; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:136006787" ncRNA 1..352 /ncRNA_class="lncRNA" /gene="LOC136006787" /product="uncharacterized LOC136006787" /db_xref="GeneID:136006787" ORIGIN
cacccgcccgtcacccatcactgtcaccggcaccggccccggctcccgtcatgggcatttaagggcagccccacggtcccacagcacccacaggaccttcaggatgtgttccggtgctcagtgtctggtgaatctcctgcgctggatctggggcatcgtgcggcgcctctggggggggcacggagtgacccccccgcctccgcccgcagctgaaagaaggacgctggtgccggacaaagaggactgagcccccccagacctgacccccccaatggggaccttgaaccccccccatagggaccttgaaccccccagtggggaccccgcacccccccatagagaccctgaaccc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]