2025-04-04 14:01:10, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XR_010176114 691 bp RNA linear VRT 25-MAR-2024 DEFINITION PREDICTED: Pseudophryne corroboree uncharacterized LOC134910094 (LOC134910094), ncRNA. ACCESSION XR_010176114 VERSION XR_010176114.1 DBLINK BioProject: PRJNA1082331 KEYWORDS RefSeq. SOURCE Pseudophryne corroboree (corroboree frog) ORGANISM Pseudophryne corroboree Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Amphibia; Batrachia; Anura; Neobatrachia; Myobatrachoidea; Myobatrachidae; Myobatrachinae; Pseudophryne. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_086447) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_028390025.1-RS_2024_02 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 02/29/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..691 /organism="Pseudophryne corroboree" /mol_type="transcribed RNA" /isolate="aPseCor3" /db_xref="taxon:495146" /chromosome="4" /sex="male" /tissue_type="kidney, liver" /dev_stage="adult" /geo_loc_name="Australia: Melbourne" /lat_lon="37.801993 S 144.959087 E" /collection_date="2020-11-03" /collected_by="Lee Berger" gene 1..691 /gene="LOC134910094" /note="uncharacterized LOC134910094; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:134910094" ncRNA 1..691 /ncRNA_class="lncRNA" /gene="LOC134910094" /product="uncharacterized LOC134910094" /db_xref="GeneID:134910094" ORIGIN
tttttacttatcaacagatggttcccatggaaatttgcctgtgacacggcccagcgcatgccaggggttggcaatacgtgaccgcagccggtccaactggcgggcagcagagctggggagcgggcgatctctatggttaccatggcgaccagcctgcgacatggtgcacggtgacgtcactagtgggcgttgcggaagcggtgccggacccatggacagacgtgttgcgccattgagcagggacagggcccactcttgctgttgggtgggaaacaatgtgaagaaaacctgcaggtttaccatgttggaacatcctacctggacaccgaaaagatgtggacacttcacccttacaacacacacttggaaggcctactggtgatgtggaaacccccttgtgtcgtgtatacctttcaggttttccttggatgtatttgcagacccagaccttgaacccctctactgtggaaagtggtgcttacaccccccctgtacctggacggcctacttgtgatgaggaccccccactctggtgtaaccaggagacccttcaggtttcccttggatgtacttgcagaccttgaacagccttggatactctgaattaccccacaccccttgaatgtctacttctaattgatgtggaatagtaatttactattactttaacaattattgaaagacaacacaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]