GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-21 13:47:19, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XR_008998512             484 bp    RNA     linear   MAM 21-JUN-2023
DEFINITION  PREDICTED: Manis pentadactyla uncharacterized LOC118908090
            (LOC118908090), ncRNA.
ACCESSION   XR_008998512
VERSION     XR_008998512.1
DBLINK      BioProject: PRJNA984222
KEYWORDS    RefSeq.
SOURCE      Manis pentadactyla (Chinese pangolin)
  ORGANISM  Manis pentadactyla
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Pholidota; Manidae; Manis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_080025) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_030020395.1-RS_2023_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/15/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..484
                     /organism="Manis pentadactyla"
                     /mol_type="transcribed RNA"
                     /isolate="mManPen7"
                     /db_xref="taxon:143292"
                     /chromosome="7"
                     /sex="male"
                     /cell_line="skin cell line fibroblast"
                     /tissue_type="cultured skin fibroblast"
                     /dev_stage="adult"
                     /geo_loc_name="Taiwan: Taipei Zoo, China"
                     /lat_lon="24.9986 N 121.5810 E"
                     /collection_date="2007-01-09"
                     /collected_by="Taipei Zoo (original animal)"
     gene            1..484
                     /gene="LOC118908090"
                     /note="uncharacterized LOC118908090; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:118908090"
     ncRNA           1..484
                     /ncRNA_class="lncRNA"
                     /gene="LOC118908090"
                     /product="uncharacterized LOC118908090"
                     /db_xref="GeneID:118908090"
ORIGIN      
caactctccatgcctggacaaacacaaaactgcatgtcttggctccctgccctcctggagtggggaagcaccctgctacactggcaggacatcagctggagtctacaggggaatgaacaaagagaatggcctcttatccacgtctgcagaaaaatcactcacgggatttgacatctgctgcacaccatggagaagacaccttattgatgaaaaagaacacagttcctgaggattgctctgggatggggaaaacttgatcatcttctgccccttgtgctcacagaaactgtttgaggtctgtctcctggggaccccaccctccatttttaggactgaatacctgaagtacagttgtcatcctgttgaatcttatgttacctgcattttatgtcttcaacttctctggttttgtttaagcaaacaatctcttcttgagaagggacagaagggaaataaaattctagatacccaatgtgtccaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]