GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-04 10:31:17, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XR_004442130            1283 bp    RNA     linear   PRI 28-MAR-2020
DEFINITION  PREDICTED: Trachypithecus francoisi claudin 17 (CLDN17), transcript
            variant X3, misc_RNA.
ACCESSION   XR_004442130
VERSION     XR_004442130.1
DBLINK      BioProject: PRJNA614514
KEYWORDS    RefSeq.
SOURCE      Trachypithecus francoisi (Francois's langur)
  ORGANISM  Trachypithecus francoisi
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Cercopithecidae; Colobinae; Trachypithecus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_022681459.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Trachypithecus francoisi Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1283
                     /organism="Trachypithecus francoisi"
                     /mol_type="transcribed RNA"
                     /isolate="TF-2019V2"
                     /db_xref="taxon:54180"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="muscle"
     gene            1..1283
                     /gene="CLDN17"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 mRNAs, 2 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 2 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:117095660"
     misc_RNA        1..1283
                     /gene="CLDN17"
                     /product="claudin 17, transcript variant X3"
                     /db_xref="GeneID:117095660"
ORIGIN      
aaaaaggcaacatgcatttacaacaggtacttctagttaggccaagttcagtcacagccactgatttggactaaaatgatatgggcagcagccaaggagaacatcatcaaagacttctccagactcaagagccttccacgttctacatcttgagcatcttctaccactccgaattggactagtcttcacagtaaaagacaatggcattttatcccttgcaaattgctgggctggttcttgggttccttggcatggtggggactgttgccacaacgcttctgcctcagtggagagtatcagcttttgttggcagcaacattattgtctttgagaggctctgggaagggctctggatgaactgcatccgacaagccagggtccggttgcaatgcaagttctatagttcattgttggctcttccgcctgtcctggaaacagcccgggcacttatgtgtgtggctgttgctctctccttggtcgccctacttattggcatctgtggcatgaagcaggtccagtgcacaggctctaatgagagggccaaagcataccttctgggaacttcaggagtcctcttcatcctgacgggcatcttcgttctgattccagtgagctggacagccaatataatcatcagagatttctacaacccagctgtccacataggtcagaaacgagagctgggagtagcacttttccttggctgggcaagcactgctgtcctcttcattggagggggtctgctttgtggattttgctgctgcaacagaaagaagcaaaggtacagatatccagtgcctggccactgtgtgccacacacagataagcgaagaaacgtgacaatgcctagtaatacctccaccagttatgtctaatgcctgcttttggctccaagtgtggactatggtcaatgtttgttataaagtcctgctagaaactatacaactgaaaatcatcctgaaatgggggcttctcagcagaatccaaggtgaacacctgaagattttaaatatcaaatcaatgacttggtttgacacgggcccacagaacttagattcaaccctgggaaaattttgcaccctcagaggcacagacagaaatttttagaaataccgtcaccacctactgcaaatgccactactgcataagctcctgtgggaaccggataaggctttgcacaaagtcgactgcagagaaagaagaggtcagtgagatcagaaaactgctatgaaaaacaaactgcacaaagtttcaagaaatgaagttttctagtcaataaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]