ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-12-10 23:41:55, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XR_003351493 267 bp RNA linear PLN 02-OCT-2018
DEFINITION PREDICTED: Papaver somniferum uncharacterized LOC113332400
(LOC113332400), ncRNA.
ACCESSION XR_003351493
VERSION XR_003351493.1
DBLINK BioProject: PRJNA492326
KEYWORDS RefSeq.
SOURCE Papaver somniferum (opium poppy)
ORGANISM Papaver somniferum
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliopsida; Ranunculales; Papaveraceae;
Papaveroideae; Papaver.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_039358.1) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Papaver somniferum Annotation
Release 100
Annotation Version :: 100
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 8.1
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..267
/organism="Papaver somniferum"
/mol_type="transcribed RNA"
/cultivar="HN1"
/db_xref="taxon:3469"
/chromosome="1"
/tissue_type="leaves"
/dev_stage="seedling"
/geo_loc_name="Australia"
gene 1..267
/gene="LOC113332400"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 100% coverage of the annotated
genomic feature by RNAseq alignments, including 9 samples
with support for all annotated introns"
/db_xref="GeneID:113332400"
ncRNA 1..267
/ncRNA_class="lncRNA"
/gene="LOC113332400"
/product="uncharacterized LOC113332400"
/db_xref="GeneID:113332400"
ORIGIN
gaagaagctggcagcactgaaaccagagaatagcactgtcaatgagtgggaagagttcgtgaaacatgtttgctcggaggaattcagaacaaaaagattctggatgcaacaaatcaggaagaaatacaccactccacacactatcagtagactgggttgggtgagactcgaggctaagatgcaaaaggaacggaaaacacaagaagagattgatagagtcgaagtttggacaacgggtcacaaacataaggaaggaaaggaacctaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]