LOCUS       XR_002611008             365 bp    RNA     linear   INV 31-AUG-2017
DEFINITION  PREDICTED: Limulus polyphemus uncharacterized LOC111086280
            (LOC111086280), ncRNA.
ACCESSION   XR_002611008
VERSION     XR_002611008.1
DBLINK      BioProject: PRJNA238073
KEYWORDS    RefSeq.
SOURCE      Limulus polyphemus (Atlantic horseshoe crab)
  ORGANISM  Limulus polyphemus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Chelicerata;
            Merostomata; Xiphosura; Limulidae; Limulus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_013666596.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Limulus polyphemus Annotation
                                           Release 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..365
                     /organism="Limulus polyphemus"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:6850"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="muscle"
                     /country="USA: Woods Hole, MA"
                     /collection_date="Jan-2008"
     gene            1..365
                     /gene="LOC111086280"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 1 sample
                     with support for all annotated introns"
                     /db_xref="GeneID:111086280"
     ncRNA           1..365
                     /ncRNA_class="lncRNA"
                     /gene="LOC111086280"
                     /product="uncharacterized LOC111086280"
                     /db_xref="GeneID:111086280"
ORIGIN      

gtggaatgaaatcagatttgaatttaaccacctgagcaaactactactttgaatgataagaatgaaccatcactactggaaacgttataccgaagcaaggatactctggaaaccatatttaggtttatcgatagagatgggtcaggtcttatctccatggaagaatttacagatgcatgccatctactaagtcaacacttagggacagctatgtcacaagaagagattgatgatttggccaagagtatagacattaacaaagacggatttattgatttcaatgagtttttggaagccttccgtcttgtagacaaggagccctcccctgtattacaggcaagagagtaaacattgttcttgtggta

//