ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-12-10 23:41:33, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XR_002591448 219 bp RNA linear PLN 01-SEP-2020
DEFINITION PREDICTED: Helianthus annuus uncharacterized LOC110938512
(LOC110938512), ncRNA.
ACCESSION XR_002591448
VERSION XR_002591448.2
DBLINK BioProject: PRJNA396063
KEYWORDS RefSeq.
SOURCE Helianthus annuus (common sunflower)
ORGANISM Helianthus annuus
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
Pentapetalae; asterids; campanulids; Asterales; Asteraceae;
Asteroideae; Heliantheae alliance; Heliantheae; Helianthus.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_035440.2) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
On Sep 1, 2020 this sequence version replaced XR_002591448.1.
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Helianthus annuus Annotation Release
101
Annotation Version :: 101
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 8.5
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..219
/organism="Helianthus annuus"
/mol_type="transcribed RNA"
/cultivar="XRQ/B"
/specimen_voucher="SF193"
/db_xref="taxon:4232"
/chromosome="8"
/tissue_type="leaves"
/dev_stage="4 leaves"
/geo_loc_name="France"
/collected_by="INRA, LIPM"
gene 1..219
/gene="LOC110938512"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 100% coverage of the annotated
genomic feature by RNAseq alignments, including 4 samples
with support for all annotated introns"
/db_xref="GeneID:110938512"
ncRNA 1..219
/ncRNA_class="lncRNA"
/gene="LOC110938512"
/product="uncharacterized LOC110938512"
/db_xref="GeneID:110938512"
ORIGIN
ctcaagtacggcgtgcaacaagtgcctacccacgtcgtcaaagaactcatcatgcacgaggtggtgcttgggggtggccaggatgcatctgctgttaccacaaccatcatcgtgcggggaagtttgaagccaaattttatgacaaggttctgcaagaagagattggaggcgttaaaggacatttcgggccaattaatgctttggcattcaacccggatg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]