2025-04-04 14:01:10, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XR_002140896 394 bp RNA linear INV 28-DEC-2016 DEFINITION PREDICTED: Branchiostoma belcheri uncharacterized LOC109481402 (LOC109481402), ncRNA. ACCESSION XR_002140896 VERSION XR_002140896.1 DBLINK BioProject: PRJNA358734 KEYWORDS RefSeq. SOURCE Branchiostoma belcheri (Belcher's lancelet) ORGANISM Branchiostoma belcheri Eukaryota; Metazoa; Chordata; Cephalochordata; Leptocardii; Amphioxiformes; Branchiostomatidae; Branchiostoma. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_017804187.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Branchiostoma belcheri Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..394 /organism="Branchiostoma belcheri" /mol_type="transcribed RNA" /isolate="BF01" /isolation_source="seawater" /db_xref="taxon:7741" /chromosome="Unknown" /sex="male" /cell_type="sperm cells" /tissue_type="gonad" /dev_stage="adult" /geo_loc_name="China: Xiamen Bay" /collection_date="Aug-2008" /breed="outbred" gene 1..394 /gene="LOC109481402" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 2 samples with support for all annotated introns" /db_xref="GeneID:109481402" ncRNA 1..394 /ncRNA_class="lncRNA" /gene="LOC109481402" /product="uncharacterized LOC109481402" /db_xref="GeneID:109481402" ORIGIN
agaaccgagattcgaatgcagacgaccggacgcgatgaaatttaggggtgaccttgaacagtttgtgatcatggcacaagaacatggaggcgccatcattctgtcacgtttcctttcgtcacacaagcaagtttagaggtgaccttgaacagttcacaagaacctgaagggcgccttgattcatggattcatgcacgctttcgttcatcacaagcaatgaagtttagaagtgatcacaagaaacatggaggatggagggcgccatcactaagtcattttttttcaccaccgaagagcaatgaagtttagaggtgaccttgaagtcaaaaacacaacaaccaagaagggcatcatcactcgctccagtttgcacgtggacacaagcacagtgagg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]