ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-21 13:47:38, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XR_001562778 444 bp RNA linear INV 14-MAR-2016
DEFINITION PREDICTED: Acropora digitifera uncharacterized LOC107337268
(LOC107337268), ncRNA.
ACCESSION XR_001562778
VERSION XR_001562778.1
DBLINK BioProject: PRJNA314803
KEYWORDS RefSeq.
SOURCE Acropora digitifera
ORGANISM Acropora digitifera
Eukaryota; Metazoa; Cnidaria; Anthozoa; Hexacorallia; Scleractinia;
Astrocoeniina; Acroporidae; Acropora.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NW_015441154.1) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Version :: Acropora digitifera Annotation
Release 100
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 6.5
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..444
/organism="Acropora digitifera"
/mol_type="transcribed RNA"
/db_xref="taxon:70779"
/chromosome="Unknown"
/geo_loc_name="Japan:Okinawa, Kunigami, Oku"
gene 1..444
/gene="LOC107337268"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 100% coverage of the annotated
genomic feature by RNAseq alignments, including 41 samples
with support for all annotated introns"
/db_xref="GeneID:107337268"
ncRNA 1..444
/ncRNA_class="lncRNA"
/gene="LOC107337268"
/product="uncharacterized LOC107337268"
/db_xref="GeneID:107337268"
ORIGIN
cagaatgggtgttcctcttgtggttttgcttgaattctgttctgagggtgataacgtcttgatgccgtcaatctcttcttgtctgctaatgagtggctcaaatttgttcccacgaaagaggtggaaaatccgttctttggacaaacaagtaattttgggattccagcatcttggtctttaatgtttggatcaccaatgcattggcatggaaacctattttagtgaggcagactcatgagttatgtacttaccataactttcacgtttgtttgatcactgttttgcgcttagtttagcaaggaacctctccatgttacgggtcattatttgtagtatttgctcaaaacgttaccatgaaacagctaccacgtgtcaaatccagtgtatcaagtttttcccgtcttccataatctctaaatcgaactacaccaatttaccaggagc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]