GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-21 12:35:45, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XR_001562778             444 bp    RNA     linear   INV 14-MAR-2016
DEFINITION  PREDICTED: Acropora digitifera uncharacterized LOC107337268
            (LOC107337268), ncRNA.
ACCESSION   XR_001562778
VERSION     XR_001562778.1
DBLINK      BioProject: PRJNA314803
KEYWORDS    RefSeq.
SOURCE      Acropora digitifera
  ORGANISM  Acropora digitifera
            Eukaryota; Metazoa; Cnidaria; Anthozoa; Hexacorallia; Scleractinia;
            Astrocoeniina; Acroporidae; Acropora.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_015441154.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Acropora digitifera Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..444
                     /organism="Acropora digitifera"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:70779"
                     /chromosome="Unknown"
                     /geo_loc_name="Japan:Okinawa, Kunigami, Oku"
     gene            1..444
                     /gene="LOC107337268"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 41 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:107337268"
     ncRNA           1..444
                     /ncRNA_class="lncRNA"
                     /gene="LOC107337268"
                     /product="uncharacterized LOC107337268"
                     /db_xref="GeneID:107337268"
ORIGIN      
cagaatgggtgttcctcttgtggttttgcttgaattctgttctgagggtgataacgtcttgatgccgtcaatctcttcttgtctgctaatgagtggctcaaatttgttcccacgaaagaggtggaaaatccgttctttggacaaacaagtaattttgggattccagcatcttggtctttaatgtttggatcaccaatgcattggcatggaaacctattttagtgaggcagactcatgagttatgtacttaccataactttcacgtttgtttgatcactgttttgcgcttagtttagcaaggaacctctccatgttacgggtcattatttgtagtatttgctcaaaacgttaccatgaaacagctaccacgtgtcaaatccagtgtatcaagtttttcccgtcttccataatctctaaatcgaactacaccaatttaccaggagc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]