LOCUS       XM_078660836            2309 bp    mRNA    linear   VRT 21-JAN-2026
DEFINITION  PREDICTED: Lissotriton helveticus copper chaperone for superoxide
            dismutase (CCS), transcript variant X1, mRNA.
ACCESSION   XM_078660836
VERSION     XM_078660836.1
DBLINK      BioProject: PRJNA1395635
KEYWORDS    RefSeq.
SOURCE      Lissotriton helveticus (palmate newt)
  ORGANISM  Lissotriton helveticus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Amphibia; Batrachia; Caudata; Salamandroidea; Salamandridae;
            Pleurodelinae; Lissotriton.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_136070) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_964261635.1-RS_2025_12
            Annotation Pipeline         :: NCBI Eukaryotic Genome Annotation
                                           Pipeline (EGAP)
            Annotation Software Version :: 10.5
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 12/30/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2309
                     /organism="Lissotriton helveticus"
                     /mol_type="mRNA"
                     /db_xref="taxon:256425"
                     /chromosome="9"
     gene            1..2309
                     /gene="CCS"
                     /note="copper chaperone for superoxide dismutase; Derived
                     by automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 88 long SRA reads, 12 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 31 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:144781823"
     CDS             113..922
                     /gene="CCS"
                     /codon_start=1
                     /product="copper chaperone for superoxide dismutase
                     isoform X1"
                     /protein_id="XP_078516962.1"
                     /db_xref="GeneID:144781823"
                     /translation="

MEKPRKQLEFAVQMTCQSCVQAVEQCLKGVQGIQAVTVNLEAESVLVDTSLTAEEVQDLIESTGRLAVLKGMGSTTQKDLGAAVAMVEGVNSIHGVVRFVQLSLEKCIIEGTIDGLKPGLHGLHVHTFGDLTDSFNKCGDHFNPDGKSHGDPKDSDRHVGDLGNILADEMGKAVFRMEDDHLKVWDIIGRSIVVDEREDDLGRGRNPLSKISGNSGERLAGGIIACSAGLFQNPKKICTCDGVTLWDERERTRASSGQSLRLPQPLANL"

     polyA_site      2309
                     /gene="CCS"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      

caaaggttacattgtggtttccgtgtttacaactaagaaagaaggcgcatgtcgggagttgacacagtcaacgaacatcagtctttaataaaacgatccactaataccctaaatggagaaacccagaaaacaactggagtttgcagtgcagatgacctgccagagttgtgtccaagctgttgaacaatgcctcaaaggagtccaaggcattcaagctgtgactgtgaacctggaagctgagagtgtgctggtagatacatcactgacagctgaggaggttcaggatctgattgagagtaccggccgcctggcagtgctgaaaggcatgggaagcaccacccagaaagacctcggtgctgctgttgccatggtcgaaggagtgaattccatacatggggtggtgcgctttgtacagttgtcgctggagaagtgtatcattgaggggaccatagatggcctgaaaccaggattgcacgggctgcatgtccatacatttggggatctcacagactcctttaacaaatgtggggaccattttaaccccgacgggaaatctcatggtgatccaaaggattcagaccggcacgtgggcgaccttggaaatatccttgctgatgagatgggaaaggcagtcttcagaatggaggatgaccacctgaaggtttgggatatcatcggtcgttctatagttgtagacgaaagggaggatgacctgggcagaggacgaaacccactctcaaaaatatctggcaactctggggaaagattggcaggtggtatcattgcatgctcagccggcctcttccagaaccccaagaagatctgcacatgtgatggggtgacactttgggatgaacgtgaacgaaccagagctagctcgggacaaagtctgcggcttccccaacctttggctaacctgtagcgacaccacgcagatgggaatacaagccatgttatggtgacatgcacaatgtgaagcagaaactgctggagataataaaccatgcaatctttcaataatcaggagatttggctattgcagctaaaaccatggattccaaggtgtgatgtgtccatgctgaggaacagtaattcaaagaacattgtgaaatatttggctgttgctacttccgactgtcccctaaatattccagcacatatgatcatggtagtgctttcttttaggcagtgtctatttgtactatcattatttttttatctattttgacaacagacatggcatgcttaagtatagaatcactgggtgacctccaatttctcccagcactactgtctgtgcccttcacaataattgacagatcactggatttaattagatagatttaaatagtggctctaattgattcgttcagatccaatttcggggaagaccagaactcaagtcttacttagatgtcagaggttgcaaaatgttaaattgttcctttactatatgttctttgatttctaatcacgagggtcgtagatggaacttggtgtataattagatgagaagccccctcatttttctagaagctttagttttcctttattttaaatattcagctgagggtgtgctatagggtgtcagtgctctgacatctggctgaatgtcaatccttgaatactgatgcgtacttttctgtgcaagactgcctctccagactctgagtctggagcttaatttttattaaacctccctctcttccattcattcctacatctaatcattttcttctaactacacttttctgcagcaccacaacacttgtctgccagtacattttcacctatttttctaatattctcactttctgcactactttcccttaactctgatgactctaaagccacttttcattttacaaaagctactagtattggttacttctatcctgagaagactgtagtttgtgcagaacgcctcagctctgcttttagtgaaagtgctgaaaaggagtcacatccagcatcaccaaaaagagcgtaatcggtttcccattaaagagcaagtccgtttcatgctgacacacagggccgtttacctaagagggcctttctatctgagaaacaggattagaccgtatattcaggatcgatctcttcactactccagtactcttttgcactaattcctatggtcatgaacattgcaaccctaattgaatagacctcttttaatctcattgcattttaaatgttttatcttttttttttcttgtttttgtttgttttaacaaggtcgtaatatgcttcgctctttgtaaatgattgttggtaatcatacaataaagtatttctagtcagtg

//