ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-01 06:00:02, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_077173722 6411 bp mRNA linear VRT 25-SEP-2025
DEFINITION PREDICTED: Agelaius phoeniceus ATPase copper transporting beta
(ATP7B), transcript variant X2, mRNA.
ACCESSION XM_077173722
VERSION XM_077173722.1
DBLINK BioProject: PRJNA1331850
KEYWORDS RefSeq.
SOURCE Agelaius phoeniceus (red-winged blackbird)
ORGANISM Agelaius phoeniceus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Australaves;
Passeriformes; Passeroidea; Icteridae; Agelaius.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_135266) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Full annotation
Annotation Name :: GCF_051311805.1-RS_2025_09
Annotation Pipeline :: NCBI Eukaryotic Genome Annotation
Pipeline (EGAP)
Annotation Software Version :: 10.5
Annotation Method :: Gnomon; cmsearch; tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 09/22/2025
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..6411
/organism="Agelaius phoeniceus"
/mol_type="mRNA"
/isolate="bAgePho1"
/db_xref="taxon:39638"
/chromosome="2"
/sex="female"
/tissue_type="blood"
/dev_stage="adult"
/geo_loc_name="USA: Millbrook, New York"
/lat_lon="41.775839 N 73.744242 W"
/collection_date="2020-06-05"
/collected_by="Melanie Couture, Jean-Nicolas Audet"
gene 1..6411
/gene="ATP7B"
/note="ATPase copper transporting beta; Derived by
automated computational analysis using gene prediction
method: Gnomon. Supporting evidence includes similarity
to: 4 Proteins, and 100% coverage of the annotated genomic
feature by RNAseq alignments, including 2 samples with
support for all annotated introns"
/db_xref="GeneID:129134662"
CDS 296..4651
/gene="ATP7B"
/codon_start=1
/product="copper-transporting ATPase 2 isoform X2"
/protein_id="XP_077029837.1"
/db_xref="GeneID:129134662"
/translation="
MERKLDNKMKRELSYLATLNDRNISLVSIRKQQAARDVPELLIIGEKSKTASPVKASSNLQKEEKLLQSYSMGMTEVNTDERQALSNIVSPPGCELKPTMKHNFAFDNIGYEASSETMPSPPSQEHTVVVNIVGMTCQSCVQSIEGRISKVNGILRIKVSLEQNNAVIKYRRSEISPEQICQEILDMGFDANIAEEKLTTATVNLPSLKEAVAKLRVEGMTCQSCVTNIEGKIRKLHGVAKIKVSLDNQEAIIAYHPYIIQPDDLKRHISDLGYDCTIKSKSAPLKLGALDLQRLQNANPRETPANFGSDGLDPLVPKMGSTATVTVQIEGMHCKSCVRNIEGNISDLPGIKSIKVSLEHKCAVVQYSPDLITLSAFQQAIESLPPGNFKVSLLSGSEANKTASPSGAFTYNVIRQPPQGTTHVAVIKIDGMTCNSCVQSIEGAVSQRQGVKNVVVSLAGSTGTIHYDPTVTSGEELRAAIEDMGFDASVLTGIVSVLVALMAGKAEIKYKPELIQPLEIAQLIQNLGFEATIMENNAETEGQVELLITGMTCASCVHNIESKLMRTNGIFSASVALATSKAHIQFDPEIIGPRDIIKVIKEIGFHASVAKRDPNAHNLSHKKEIQQWRKSFLYSLAFGIPVVVLMIYMQIPNGEDHGSKVLEQNLIPGLSILNLLFFILCTFVQFLGGWYFYVQAYKSLRHKTANMDVLIVLATTIAYVYSCVILIVAILEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKGKTSEALAKLMSLQATEATVVTLGPGHSIVREEQVPVELVQRGDIIKVVPGGKFPVDGKVIDGSSMADESLITGEPMPVIKKPGSTVIAGSINAYGSLLVNATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIAWITIGFVNFDIIKKYFPNQSKNISKAEIILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHQIKTVMFDKTGTITYGVPKVMRLLLMGDTAVLPLKKVLAVVGTAEASSEHPLGMAVTKYCKEELGTESLGYCTDFQAVPGCGISCKVGGVEAILGTAEEAPNKLDANRTGNSSAPLGDSGVIPLLESQGPSASQKYSVLIGNREWMRRNGLNIANDVNDAMTNHEMKGQTAILVAIDGALCGMIAIADTVKQEAALAVHTLQSMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGKKKVAMVGDGVNDSPALAKADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPLGLVLQPWMGSAAMAASSVSVLLSSLQLKCYKKPDTESYEAQAQGRMKPLTPSQISVHIGMDDRRRDSSKPSPWDQTSQVSLSSLASDRLPRHNGFIQEEGGKWSLLINRADEEQYI"
misc_feature 680..868
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(698..706,713..715)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 935..1126
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(953..961,968..970)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1259..1447
/gene="ATP7B"
/note="Copper chaperone CopZ [Inorganic ion transport and
metabolism]; Region: CopZ; COG2608"
/db_xref="CDD:442020"
misc_feature 1568..1771
/gene="ATP7B"
/note="Copper chaperone CopZ [Inorganic ion transport and
metabolism]; Region: CopZ; COG2608"
/db_xref="CDD:442020"
misc_feature 1928..2119
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(1946..1954,1961..1963)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 2183..4324
/gene="ATP7B"
/note="P-type heavy metal-transporting ATPase, similar to
human copper-transporting ATPases, ATP7A and ATP7B;
Region: P-type_ATPase_Cu-like; cd02094"
/db_xref="CDD:319783"
misc_feature order(3176..3178,3182..3184,4253..4255)
/gene="ATP7B"
/note="putative Cu binding site [ion binding]; other site"
/db_xref="CDD:319783"
misc_feature order(3308..3316,3518..3520,3704..3712,3800..3802,
3920..3928,3986..3988,3995..3997,4004..4006,4061..4063,
4070..4072)
/gene="ATP7B"
/note="putative ATP binding site [chemical binding]; other
site"
/db_xref="CDD:319783"
polyA_site 6411
/gene="ATP7B"
/experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN
tgcagagatcagcagtgccggacgcagctgggaaggcacgagggatgccgattggtgggaaacatttgaactggcagggagagcaggtagctgagtgcagcaagcagcctacataaggatcacaggttgcatctgggatttcctgatgaatgcctaataagcacatggattagatgggcagaactcttcaagctgttgtaaatgtagctgaaagaagcgtggcttggaggacaacaaataactgctctcgtgaaacttttttttggcattgcaatatttaaagcccagaaaaataatggagagaaaactggacaataaaatgaaaagggaactgtcctacttagctactttaaacgacagaaacatatccttggtgtctattcgtaagcagcaggcagctcgtgatgtgcctgaactactgattattggtgaaaagtccaagacggcatctccggtaaaagcaagcagtaacttgcagaaagaagagaaacttttgcagagttactccatgggaatgacagaagtcaatacagatgaaaggcaggctttgtccaacatcgtttctcctcctggttgtgagctgaagcctacaatgaagcataattttgcttttgacaacataggctatgaggcaagctctgaaaccatgccctctccaccttcccaagagcatactgtggtagtcaacattgtgggaatgacctgccaatcatgtgtgcagtcgatagaaggccgaatttccaaggtgaacggcattttgagaattaaagtctcccttgaacagaacaacgctgttatcaagtatcggcggtcggaaataagccctgaacagatttgccaggaaattctggatatgggctttgacgccaacatagctgaagagaagttgacaacagcaactgtaaatttgccaagcttgaaagaagcagtagctaagcttcgggtagaaggcatgacatgccagtcctgtgtcaccaacattgaaggaaagattaggaaactgcacggtgtggcaaaaatcaaggtgtcacttgataaccaagaagcaattattgcttaccatccttacatcattcagcctgatgacctcaagagacacatcagtgacctggggtacgactgcaccattaaaagtaaatcagcccctttgaagctgggtgcccttgatctccagcgcttgcagaatgcaaaccccagggagacacccgcaaattttgggagtgatgggctggatccactggtccccaagatgggtagcacagcaacagtgactgtacagatagagggcatgcactgcaagtcctgtgtcagaaacatcgaaggaaatatatcagatcttcctggcataaaaagtattaaagtgtctttggagcataaatgtgctgtggtacagtacagcccagatttaatcaccctgtcagctttccagcaagctatcgaatcccttccacctggaaactttaaagtgagcctccttagtggttcagaagcaaataaaacagcatctccctcaggtgctttcacatacaatgtcatcagacagccaccacaaggcacgacacatgtggctgttattaagattgatggcatgacctgcaattcttgtgtccagtccatagaaggggctgtatcacagaggcagggagtgaagaatgtagtagtttctctagctggcagtactgggaccatacactatgatccaactgtcactagtggagaagagttaagagctgccatagaagacatgggatttgatgcctctgtgctgacaggaattgtttcagtgttagtagcactgatggcaggtaaagcagagataaaatacaagccagaactcatacagcctcttgaaatagcacagctgatccagaatttgggttttgaagctaccatcatggaaaataatgcagaaacagaagggcaagtggagcttcttattacagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattctctgcctcagttgcacttgcaactagcaaagctcacatccagtttgatcctgaaattattggacctcgagatattataaaagtaatcaaggaaattggctttcatgcttctgtggctaaaagagatccaaatgcacataacctgagtcataaaaaggaaatacagcagtggaggaaatctttcttgtacagcctagcatttggtatccctgttgtagtcttaatgatttatatgcaaatacccaatggtgaagaccatgggtctaaggtcctggaacagaacctcattcctggattatctattttgaatcttctcttttttatcctgtgcacttttgttcagttccttggtggatggtatttttacgtgcaagcttacaagtccctgaggcacaagacagccaatatggatgtgctcatcgtgctggccacgacgattgcttatgtgtattcctgcgtgatcctgatagtagcaatccttgaaaaggcagagaaaagccctgtcactttcttcgacactcctcccatgttgtttgtgttcattgcgctcggcagatggctggaacacatagccaagggcaagacctcagaagctcttgctaagcttatgtctcttcaagccacagaagccactgtggtgacccttggacctggccactctattgtcagggaggagcaagtacctgttgaactggttcaaaggggtgatattataaaagttgttcctggtggaaagttcccagtggatggaaaggtcattgacggcagttctatggcagatgagtctctcattactggggaacctatgccagtcattaaaaagcctgggagcacagtgattgctggttctataaatgcatatggctcacttcttgttaatgcaactcatgttggtagtgataccactctggcacagattgtaaaattggtggaagaagctcaaatgtcaaaggcacctatccagcaactggcagataaatttagtggatactttgttccatttatcatcatcatttcaactgtgacattgatagcatggatcacaattggttttgtaaactttgatattattaaaaaatattttcctaatcagagcaaaaacatttcaaaagctgaaataatactgaggtttgcattccaaacctcaatcactgtgctgagcattgcatgcccttgctctttaggcctggctacccccacagctgtaatggtgggcacaggagtggctgcgcagaatggaattctcatcaaaggtggaaaacccctggaaatggcacatcagatcaagactgtgatgtttgataaaacggggaccatcacctatggagttcctaaagtcatgaggctgcttttgatgggagacacagctgtgctccccctgaagaaagtgctggctgttgttggtacagcagaggccagcagcgagcatcctttaggaatggctgtcactaaatactgcaaagaggagcttggcactgagagcctgggatactgcaccgacttccaggcagtcccaggctgtggtatcagctgcaaggttggaggagttgaggccatccttggcacagctgaggaagctcccaataagctggatgctaacaggactgggaacagcagcgctcctctgggagatagtggagttatcccactcttggaatcacaaggtccatcagcttctcagaaatactcggtgttgatcggaaatcgtgagtggatgcgacgcaatggcttgaatattgcaaatgatgtaaatgatgcaatgacaaaccatgaaatgaaaggacagactgccatactagtggctatagatggtgcattgtgtggaatgattgccatagcagacactgtcaagcaggaggcagcccttgctgtgcacacactgcagagcatgggaatagacgtggtgctcataacaggggacaacaggaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgcagaggttcttccttctcacaaagttgcaaaggtccaggagctccaaaatggaaagaagaaggttgcaatggttggtgatggagtcaacgattcccctgcactagccaaggctgatgttggaattgcaattggaacgggcaccgatgttgccattgaagctgcagatgttgtccttatccgaaatgatttgctggatgtagttgccagtattcacttatccaagagaacagttcgaagaatacgaataaatctgattcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctcttggcctcgtgcttcagccttggatggggtcagctgcaatggcagcttcttctgtgtctgtcctgctgtcttcactgcagctgaaatgttacaagaagccggacacagaaagttacgaagcgcaagctcaaggccgcatgaagccactcactccttctcaaatcagtgttcacattggaatggacgataggaggagggactcttccaaaccatctccttgggaccagacaagccaagtgtccctctcctccctggcttcagacaggctgccaagacacaatggcttcatccaggaggaagggggcaagtggtcattgctcataaacagagcggatgaggagcagtacatctgaagctctggacacttagtgcagggggaaatgttcctcctccccagccaggggagggactgacttacttcatcagcagcttcagtgttgtaagtgaagtattccttcagctcataagacaactgcaactcagctcagcgttgggttgtatggattgtggatttttttcaggtcaccagttatttctagttatggaaataatctgtgccactgtaatgaactggcttgtttgcacacagcatttagtgaaataatgtaaaattgtaatttgcagagtctaaaagagtttctctgtgactctttgctaggaaccaaatttcatacttttcaatctgtcaatatttattacttcaagaccacatgaagcaagagtattttcagagctgccaaatattaatttgtgtctaaatgaaattatcaatggcataagggactatgtggtcagaatttgaatttttacacagaatcctaactagtcatgtcactctgggaacactttgtatttatggcatctcctgggaccaaaaatactttgttagttcacctgcttcaactctctgaaaggtctttttcaaagattttcactgctttgaggtattgcatccttttgatgcacatttctactgctctctttgattttctcttttgctccatatgagcccctttcccctttttcttgcacaagagatcttctatgagttatcattatgtttacagatatttctatttgggacaaactcctttaagtcaccaggaacctttccattccagttgaaatccataaaggcagagcagttcctggtcccagttatccaagataccttgctggaccccagggagctcctcagagttgggcagttgtctgtctcttttctctgacagagtgaagaatttatgccagtgtgggcaaaggtggtatttaccttggcatgactgagcagaactagcactggtgagactccagtgtagctgaacagagggagattattgcataacttaaccccagcttgctggttgcttaaaatgcagctaaaattttatattataaaggtggaaaatggccttaaagtgggcttctatttgccatcatatgaataaatgacaggacctcaactaagaaaatttgtaatttaaatttgtatttatttttttgcattggttttagttcccctctttacttcaatgagaaatcaaagtactggacaacccttttttgctttagcatctttaccaaagcttgcagtaacttcatccctgtggatgtcagattcaccccttaacactttttagagtcaggacagtaggaatcaacagttttggtgcactggatgcagttccagagtgccgtgttgtccagctgtgggactctgatgtaagcagagttttatagtcaaagaaatactttgctaaacaacatgaaataattgcttcttttcattgactgaaatatagagctgtttctaacatgagttcaaatactgcttctcctaatgtaaaaatgaaaaacaagtcggagaggaaaagaattgttcttaaaacatttgatgagtcttcccattttctcagcactgtcttaaatataattacaaatcagttttaaaactctatataagtagagattactttcacagcacacatacttttcaaacatgccataggtgcatgtccgcgtgggaaagagggtctgaagttttactgttctgtattttcttaccagtccttacagtaaaaatatgctttggtttttaaaaaaaataaacaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]