2025-08-29 17:51:47, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XM_071540880 1127 bp mRNA linear VRT 24-FEB-2025 DEFINITION PREDICTED: Centroberyx affinis homeobox protein Meis1-like (LOC139662238), mRNA. ACCESSION XM_071540880 VERSION XM_071540880.1 DBLINK BioProject: PRJNA1226274 KEYWORDS RefSeq. SOURCE Centroberyx affinis (redfish) ORGANISM Centroberyx affinis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Berycimorphaceae; Beryciformes; Berycidae; Centroberyx. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_027281619) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_046629955.1-RS_2025_02 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 02/21/2025 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1127 /organism="Centroberyx affinis" /mol_type="mRNA" /isolate="AG114_WGS23_722 - 3" /db_xref="taxon:166261" /chromosome="Unknown" /tissue_type="gill" /dev_stage="subadult" /ecotype="Tasmania" /geo_loc_name="Australia: Bass Strait, Tasmania" /collection_date="2023" gene 1..1127 /gene="LOC139662238" /note="homeobox protein Meis1-like; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 24 Proteins" /db_xref="GeneID:139662238" CDS 171..1127 /gene="LOC139662238" /codon_start=1 /product="homeobox protein Meis1-like" /protein_id="XP_071396981.1" /db_xref="GeneID:139662238" /translation="
MAQRYEDLAHYGLEGVGGVYGDPHHAARSLQAVHLNPAGPYPPHQYAHPAHPAHPAHPGMGPAANDAVKRDKDAIYGHPLFPLLALIFEKCELATCTPRESGVAGGDVCSSDSFNEDIAVFSKQIRSEKPLFSSNPELDNLMIQAIQVLRFHLLELEKVHELCDNFCHRYISCLKGKMPIDLVIDDRDGNKSDSEEFSRSSGNIDQISWSRDHDDAASIRSAGTPGPSSGGHTSHSGDNSSEQGDCLDNGVASPSTGDDDDPDKEKRHNKKRGIFPKVATNIMRAWLFQHLTHPYPSEEQKKQLAQDTGLTILQVNNW"
misc_feature 483..737 /gene="LOC139662238" /note="N-terminal of Homeobox Meis and PKNOX1; Region: Meis_PKNOX_N; pfam16493" /db_xref="CDD:465140" misc_feature 1029..>1124 /gene="LOC139662238" /note="Homeobox KN domain; Region: Homeobox_KN; pfam05920" /db_xref="CDD:428673" ORIGIN
gtgagtgtgagtgtgtgtgtgtgtgtgtgtgttttctatccgttggactttacaccgtcggtccgtctgagacacacacggaattattgatctctcctccggtaccgggagttggatgtgtattctgccccgcagcagggaagcggagtcgggctggagagaccgggccgatggcgcaacggtatgaagacctggcccactacgggctggagggggtggggggggtgtacggcgacccccaccacgccgcccgctccctgcaggccgtccacctgaaccccgccggcccgtacccgccgcaccagtacgcccaccccgcccaccccgcccaccccgcccaccccggcatgggccccgccgccaacgacgccgtcaagagagacaaagacgccatttacggtcatcccttgttccctctgctcgcactgatctttgaaaaatgtgaattagcgacctgcacgccgagagagagcggcgtggccgggggagacgtctgctcctcggactccttcaacgaggacatcgcggtgttttccaagcagatccgatcagagaaacctttattttcatcaaacccagagttggataatttgatgattcaggcgatccaggtgttgcggttccacctcctggagctcgagaaggttcacgaactttgcgataatttctgtcatcgatacatcagctgtctgaaggggaagatgccgatcgatctggtgatcgacgacagagacggaaacaagtccgacagcgaggagttcagcagatcatcagggaatatcgatcagatctcgtggagcagagatcacgacgacgcggcgtcgatccggtcggccgggacgccgggcccgtccagcggcgggcacacgtcccacagcggggacaacagcagcgaacaaggtgactgcctggataacggcgtggcgtctcccagcacgggggacgacgacgaccccgacaaggagaagcggcacaacaagaagagaggcatcttccccaaagtggcgaccaacatcatgcgggcgtggctcttccagcacctgacccacccatacccgtcggaggagcagaagaagcagctagcgcaggacaccggcctcaccatcctgcaggtcaacaactggtga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]