GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-04 14:58:30, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_067333811            2622 bp    mRNA    linear   INV 15-AUG-2024
DEFINITION  Trypanosoma melophagium PAZ domain (LSM04_001192), partial mRNA.
ACCESSION   XM_067333811
VERSION     XM_067333811.1
DBLINK      BioProject: PRJNA1147289
            BioSample: SAMN23701209
KEYWORDS    RefSeq.
SOURCE      Trypanosoma melophagium
  ORGANISM  Trypanosoma melophagium
            Eukaryota; Discoba; Euglenozoa; Kinetoplastea; Metakinetoplastina;
            Trypanosomatida; Trypanosomatidae; Trypanosoma; Megatrypanum.
REFERENCE   1  (bases 1 to 2622)
  AUTHORS   Oldrieve,G.R., Malacart,B., Lopez-Vidal,J. and Matthews,K.R.
  TITLE     The genomic basis of host and vector specificity in non-pathogenic
            trypanosomatids
  JOURNAL   Biol Open (2022) In press
  REMARK    DOI: 10.1242/bio.059237
REFERENCE   2  (bases 1 to 2622)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (15-AUG-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 2622)
  AUTHORS   Oldrieve,G.R.
  TITLE     Direct Submission
  JOURNAL   Submitted (11-JAN-2022) Institute for Immunology and Infection
            Research, University of Edinburgh, Charlotte Auerbach Road,
            Edinburgh, Midlothian EH9 3FL, United Kingdom
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_027125191).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..2622
                     /organism="Trypanosoma melophagium"
                     /mol_type="mRNA"
                     /isolate="St. Kilda"
                     /isolation_source="blood"
                     /host="Ovis aries"
                     /db_xref="taxon:715481"
                     /chromosome="Unknown"
                     /ecotype="St. Kilda"
                     /geo_loc_name="United Kingdom: Scotland, St. Kilda"
                     /lat_lon="57.8287 N 8.6352 W"
                     /collection_date="2020-09-17"
     gene            <1..>2622
                     /locus_tag="LSM04_001192"
                     /db_xref="GeneID:92523055"
     CDS             1..2622
                     /locus_tag="LSM04_001192"
                     /codon_start=1
                     /product="PAZ domain"
                     /protein_id="XP_067186217.1"
                     /db_xref="GeneID:92523055"
                     /translation="
MSADRGGERGGRGGRGGGGGRGGRGGGERGSRGGGGGGRGGRGGGFFLGDSHKNQSREKDAIMEFAEKTYSCPLEAYSNLFPLNIDTKKHIYINTVSYEMKGGAVDLQDRLKIKACVELLKKMKKEIGNQNSFDFEICVCTGQFILSPQQLPIEEYSFDFEVKGKRGKATQFYQLTIAKRESIVLDIDKHRTEINSIIGKAVKTCYREKLGEKYVDINGNGTTVGGKIATFDGVIPKVLATTIKGNKKTVLQIDISVTVVSTRNCLLVMEDLKRSGSRNFERLLSERFLKKKLCTVYGGSRGSIYTVTGISTTKAKDVARIKGNPEQTYVQYFAQRYRIHINPDQILFECKTSSGKKVLIPPEVLYDLSIDEQDRRLLPLLCSVYPNDRKSRVSEVLRRLKTEENGAAIDILKKYGITFSDEAFLVSGHVLGPVEILIPQGNGYKSVKTLGENNQQGFLKELQVLRHPGNRRSLDVAIYDDTNRGEIVLSVIKKNLDSINAPVQLKNIHRLDNVRAAKGLSYKEMMGFAFFRQHEKENYQSLKSIWTTEGIFSQMIVKDLTGYREASIVKAVAQQVSAKNGNLNWVLDLQKCCPSLTKKMSGGSGALVIAGDVGRDQINIRSENLTTRESIYTVAFVAFFVRGKEWMTYCNHYHVNGRKETIFSTAPDTESSRHSGGSLLPSEVLSIKMEEFIKDALRHFKQKGFQVSAVVFLRGCASEGELINARQHDIDFLSGYFKDNVAWAAVAAQRYVHTRFSAPTPKDHSFLCNVPRGFVTEEGTDNRFGESFFLTGANCTLGHARSTLYVIFGRKDNFELRELQSLIYGMGFLYPNKTDGLPLPLPLKCASEYARKYVPLRNVKALPDSLRTSMHYL"
     misc_feature    793..1179
                     /locus_tag="LSM04_001192"
                     /note="PAZ domain, named PAZ after the proteins Piwi
                     Argonaut and Zwille. PAZ is found in two families of
                     proteins that are essential components of RNA-mediated
                     gene-silencing pathways, including RNA interference, the
                     piwi and Dicer families. PAZ functions as a...; Region:
                     PAZ; cl00301"
                     /db_xref="CDD:469713"
     misc_feature    order(913..915,985..987,997..999,1048..1050,1072..1074,
                     1078..1080)
                     /locus_tag="LSM04_001192"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239207"
     misc_feature    1600..2553
                     /locus_tag="LSM04_001192"
                     /note="PIWI domain. Domain found in proteins involved in
                     RNA silencing. RNA silencing refers to a group of related
                     gene-silencing mechanisms mediated by short RNA molecules,
                     including siRNAs, miRNAs, and heterochromatin-related
                     guide RNAs. The central component...; Region: Piwi-like;
                     cl00628"
                     /db_xref="CDD:412485"
     misc_feature    order(1615..1617,1627..1629,1660..1671,1681..1683,
                     1702..1704,1711..1713,1723..1725,1735..1737)
                     /locus_tag="LSM04_001192"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:239208"
     misc_feature    order(1834..1836,1840..1842,2143..2145,2551..2553)
                     /locus_tag="LSM04_001192"
                     /note="active site"
                     /db_xref="CDD:239208"
ORIGIN      
atgagtgcagatcggggaggagaacgtggaggccgcggtggtcgtggtggtggaggaggacgtggaggccgaggaggcggtgaacgtggtagtcgtggtggaggaggaggaggacgtggaggccgaggaggaggattttttttgggtgattcccataagaatcaatcgagagaaaaagacgcgatcatggaatttgcagagaaaacgtatagttgcccattggaggcttattcaaatcttttccccttgaatattgatacgaaaaagcatatttacattaatactgtttcgtatgaaatgaaaggaggtgctgtcgatcttcaagatcgattaaagataaaagcttgcgtagaacttttaaaaaagatgaaaaaagaaattgggaatcaaaattcatttgactttgaaatatgcgtctgtacgggacaatttatactctcccctcaacaacttcccattgaagaatattcgtttgattttgaagtcaagggaaagaggggtaaagcaacgcagttttatcaactaacaattgctaaaagagaatcaattgtactggatattgacaaacacagaactgaaatcaatagtattattggaaaagcagtgaaaacatgttacagggaaaaattaggagaaaaatatgtggatataaatgggaatggaaccactgttggtggcaaaattgccacttttgatggggttattcctaaggtgcttgcaaccactataaagggtaataaaaaaaccgtactacaaattgatatttctgtcactgtagtttctacacgaaattgtctactggtgatggaagaccttaagagaagtggttcaagaaattttgagagattactaagtgaaagatttttaaaaaaaaaactttgtacggtttatggcggatcaagaggaagcatatatactgttacaggaatcagcacgacaaaagcaaaagatgttgccagaataaaaggaaaccctgaacaaacatatgttcaatattttgcacaacgctaccgaatacatataaaccctgatcaaatattatttgagtgcaaaacttcttcaggtaaaaaggtccttataccacctgaggttttgtacgatttatctattgatgaacaagacagacgtctactgcctttattatgctctgtctatccaaatgatagaaaaagccgtgtgagtgaagttttaagacgacttaagactgaagaaaatggtgccgcgatagatatactaaagaaatacggcattacattttcggatgaagcatttttggtcagtggccatgttctgggtcctgtggaaatactcattccacaaggtaatggatataagagtgtaaaaacacttggtgaaaataatcagcaaggcttcctaaaggaattacaagttttacgacatcccgggaatcgccgttctttggatgtcgcaatctatgatgacacaaaccgcggtgaaattgtcttgagcgttatcaagaaaaatcttgattctataaatgctccggtgcaattgaaaaacatacatcgtttggacaatgtcagggctgctaaaggcctttcgtataaagaaatgatgggctttgctttttttcgacaacatgaaaaagaaaattatcaatctctaaagtcaatatggacgaccgaaggaatattcagccaaatgatcgtgaaagacttaacaggatatagagaggcatctatagtaaaggcagtagctcaacaagtttctgcaaaaaatggaaatttaaactgggttttggatcttcagaaatgttgcccttcactaactaaaaaaatgtctggaggcagtggagcactggtgattgcaggggacgttggaagggatcaaataaacattagatcggaaaatttaacaacaagagaatcaatttatacagttgcttttgttgctttttttgtgcgcggtaaagaatggatgacgtactgtaatcattatcatgttaacggaagaaaagaaacaattttttcaactgcccctgatactgaaagttcacgtcattctggagggagtttacttccatcagaagtactttctataaaaatggaagaatttataaaagatgcactaagacacttcaagcaaaaaggtttccaggtttcagccgttgtatttttgcgtggctgtgcatctgaaggtgagctaataaatgccagacaacatgatattgattttttaagtggttatttcaaagacaacgtcgcatgggctgctgtagcagcgcaacgttatgtacacacccgttttagcgcaccaacaccaaaagatcattcctttttatgtaatgttccacggggttttgtgacagaggaaggaacagataacagatttggtgaatctttctttctaaccggagcaaattgtactcttggtcatgcacgttccacgttgtacgttatttttggaaggaaagacaactttgaactacgtgaattgcagagcctcatttatgggatggggtttctttaccccaataaaaccgatgggttaccacttccacttccgctgaagtgtgcatccgaatacgcaagaaaatatgttcccctgcgaaatgtaaaagcactgccagattctttgcgaacaagtatgcactatctgtag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]