2025-04-04 14:58:30, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XM_067333811 2622 bp mRNA linear INV 15-AUG-2024 DEFINITION Trypanosoma melophagium PAZ domain (LSM04_001192), partial mRNA. ACCESSION XM_067333811 VERSION XM_067333811.1 DBLINK BioProject: PRJNA1147289 BioSample: SAMN23701209 KEYWORDS RefSeq. SOURCE Trypanosoma melophagium ORGANISM Trypanosoma melophagium Eukaryota; Discoba; Euglenozoa; Kinetoplastea; Metakinetoplastina; Trypanosomatida; Trypanosomatidae; Trypanosoma; Megatrypanum. REFERENCE 1 (bases 1 to 2622) AUTHORS Oldrieve,G.R., Malacart,B., Lopez-Vidal,J. and Matthews,K.R. TITLE The genomic basis of host and vector specificity in non-pathogenic trypanosomatids JOURNAL Biol Open (2022) In press REMARK DOI: 10.1242/bio.059237 REFERENCE 2 (bases 1 to 2622) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (15-AUG-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 2622) AUTHORS Oldrieve,G.R. TITLE Direct Submission JOURNAL Submitted (11-JAN-2022) Institute for Immunology and Infection Research, University of Edinburgh, Charlotte Auerbach Road, Edinburgh, Midlothian EH9 3FL, United Kingdom COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_027125191). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..2622 /organism="Trypanosoma melophagium" /mol_type="mRNA" /isolate="St. Kilda" /isolation_source="blood" /host="Ovis aries" /db_xref="taxon:715481" /chromosome="Unknown" /ecotype="St. Kilda" /geo_loc_name="United Kingdom: Scotland, St. Kilda" /lat_lon="57.8287 N 8.6352 W" /collection_date="2020-09-17" gene <1..>2622 /locus_tag="LSM04_001192" /db_xref="GeneID:92523055" CDS 1..2622 /locus_tag="LSM04_001192" /codon_start=1 /product="PAZ domain" /protein_id="XP_067186217.1" /db_xref="GeneID:92523055" /translation="
MSADRGGERGGRGGRGGGGGRGGRGGGERGSRGGGGGGRGGRGGGFFLGDSHKNQSREKDAIMEFAEKTYSCPLEAYSNLFPLNIDTKKHIYINTVSYEMKGGAVDLQDRLKIKACVELLKKMKKEIGNQNSFDFEICVCTGQFILSPQQLPIEEYSFDFEVKGKRGKATQFYQLTIAKRESIVLDIDKHRTEINSIIGKAVKTCYREKLGEKYVDINGNGTTVGGKIATFDGVIPKVLATTIKGNKKTVLQIDISVTVVSTRNCLLVMEDLKRSGSRNFERLLSERFLKKKLCTVYGGSRGSIYTVTGISTTKAKDVARIKGNPEQTYVQYFAQRYRIHINPDQILFECKTSSGKKVLIPPEVLYDLSIDEQDRRLLPLLCSVYPNDRKSRVSEVLRRLKTEENGAAIDILKKYGITFSDEAFLVSGHVLGPVEILIPQGNGYKSVKTLGENNQQGFLKELQVLRHPGNRRSLDVAIYDDTNRGEIVLSVIKKNLDSINAPVQLKNIHRLDNVRAAKGLSYKEMMGFAFFRQHEKENYQSLKSIWTTEGIFSQMIVKDLTGYREASIVKAVAQQVSAKNGNLNWVLDLQKCCPSLTKKMSGGSGALVIAGDVGRDQINIRSENLTTRESIYTVAFVAFFVRGKEWMTYCNHYHVNGRKETIFSTAPDTESSRHSGGSLLPSEVLSIKMEEFIKDALRHFKQKGFQVSAVVFLRGCASEGELINARQHDIDFLSGYFKDNVAWAAVAAQRYVHTRFSAPTPKDHSFLCNVPRGFVTEEGTDNRFGESFFLTGANCTLGHARSTLYVIFGRKDNFELRELQSLIYGMGFLYPNKTDGLPLPLPLKCASEYARKYVPLRNVKALPDSLRTSMHYL"
misc_feature 793..1179 /locus_tag="LSM04_001192" /note="PAZ domain, named PAZ after the proteins Piwi Argonaut and Zwille. PAZ is found in two families of proteins that are essential components of RNA-mediated gene-silencing pathways, including RNA interference, the piwi and Dicer families. PAZ functions as a...; Region: PAZ; cl00301" /db_xref="CDD:469713" misc_feature order(913..915,985..987,997..999,1048..1050,1072..1074, 1078..1080) /locus_tag="LSM04_001192" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239207" misc_feature 1600..2553 /locus_tag="LSM04_001192" /note="PIWI domain. Domain found in proteins involved in RNA silencing. RNA silencing refers to a group of related gene-silencing mechanisms mediated by short RNA molecules, including siRNAs, miRNAs, and heterochromatin-related guide RNAs. The central component...; Region: Piwi-like; cl00628" /db_xref="CDD:412485" misc_feature order(1615..1617,1627..1629,1660..1671,1681..1683, 1702..1704,1711..1713,1723..1725,1735..1737) /locus_tag="LSM04_001192" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:239208" misc_feature order(1834..1836,1840..1842,2143..2145,2551..2553) /locus_tag="LSM04_001192" /note="active site" /db_xref="CDD:239208" ORIGIN
atgagtgcagatcggggaggagaacgtggaggccgcggtggtcgtggtggtggaggaggacgtggaggccgaggaggcggtgaacgtggtagtcgtggtggaggaggaggaggacgtggaggccgaggaggaggattttttttgggtgattcccataagaatcaatcgagagaaaaagacgcgatcatggaatttgcagagaaaacgtatagttgcccattggaggcttattcaaatcttttccccttgaatattgatacgaaaaagcatatttacattaatactgtttcgtatgaaatgaaaggaggtgctgtcgatcttcaagatcgattaaagataaaagcttgcgtagaacttttaaaaaagatgaaaaaagaaattgggaatcaaaattcatttgactttgaaatatgcgtctgtacgggacaatttatactctcccctcaacaacttcccattgaagaatattcgtttgattttgaagtcaagggaaagaggggtaaagcaacgcagttttatcaactaacaattgctaaaagagaatcaattgtactggatattgacaaacacagaactgaaatcaatagtattattggaaaagcagtgaaaacatgttacagggaaaaattaggagaaaaatatgtggatataaatgggaatggaaccactgttggtggcaaaattgccacttttgatggggttattcctaaggtgcttgcaaccactataaagggtaataaaaaaaccgtactacaaattgatatttctgtcactgtagtttctacacgaaattgtctactggtgatggaagaccttaagagaagtggttcaagaaattttgagagattactaagtgaaagatttttaaaaaaaaaactttgtacggtttatggcggatcaagaggaagcatatatactgttacaggaatcagcacgacaaaagcaaaagatgttgccagaataaaaggaaaccctgaacaaacatatgttcaatattttgcacaacgctaccgaatacatataaaccctgatcaaatattatttgagtgcaaaacttcttcaggtaaaaaggtccttataccacctgaggttttgtacgatttatctattgatgaacaagacagacgtctactgcctttattatgctctgtctatccaaatgatagaaaaagccgtgtgagtgaagttttaagacgacttaagactgaagaaaatggtgccgcgatagatatactaaagaaatacggcattacattttcggatgaagcatttttggtcagtggccatgttctgggtcctgtggaaatactcattccacaaggtaatggatataagagtgtaaaaacacttggtgaaaataatcagcaaggcttcctaaaggaattacaagttttacgacatcccgggaatcgccgttctttggatgtcgcaatctatgatgacacaaaccgcggtgaaattgtcttgagcgttatcaagaaaaatcttgattctataaatgctccggtgcaattgaaaaacatacatcgtttggacaatgtcagggctgctaaaggcctttcgtataaagaaatgatgggctttgctttttttcgacaacatgaaaaagaaaattatcaatctctaaagtcaatatggacgaccgaaggaatattcagccaaatgatcgtgaaagacttaacaggatatagagaggcatctatagtaaaggcagtagctcaacaagtttctgcaaaaaatggaaatttaaactgggttttggatcttcagaaatgttgcccttcactaactaaaaaaatgtctggaggcagtggagcactggtgattgcaggggacgttggaagggatcaaataaacattagatcggaaaatttaacaacaagagaatcaatttatacagttgcttttgttgctttttttgtgcgcggtaaagaatggatgacgtactgtaatcattatcatgttaacggaagaaaagaaacaattttttcaactgcccctgatactgaaagttcacgtcattctggagggagtttacttccatcagaagtactttctataaaaatggaagaatttataaaagatgcactaagacacttcaagcaaaaaggtttccaggtttcagccgttgtatttttgcgtggctgtgcatctgaaggtgagctaataaatgccagacaacatgatattgattttttaagtggttatttcaaagacaacgtcgcatgggctgctgtagcagcgcaacgttatgtacacacccgttttagcgcaccaacaccaaaagatcattcctttttatgtaatgttccacggggttttgtgacagaggaaggaacagataacagatttggtgaatctttctttctaaccggagcaaattgtactcttggtcatgcacgttccacgttgtacgttatttttggaaggaaagacaactttgaactacgtgaattgcagagcctcatttatgggatggggtttctttaccccaataaaaccgatgggttaccacttccacttccgctgaagtgtgcatccgaatacgcaagaaaatatgttcccctgcgaaatgtaaaagcactgccagattctttgcgaacaagtatgcactatctgtag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]