GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-03 14:10:44, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XM_065402964            3036 bp    mRNA    linear   VRT 17-MAY-2024
DEFINITION  PREDICTED: Emys orbicularis ATPase copper transporting beta
            (ATP7B), transcript variant X1, mRNA.
ACCESSION   XM_065402964
VERSION     XM_065402964.1
DBLINK      BioProject: PRJNA1107594
KEYWORDS    RefSeq.
SOURCE      Emys orbicularis (European pond turtle)
  ORGANISM  Emys orbicularis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Testudinata; Testudines; Cryptodira; Durocryptodira;
            Testudinoidea; Emydidae; Emys.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_088683) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_028017835.1-RS_2024_05
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 05/09/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3036
                     /organism="Emys orbicularis"
                     /mol_type="mRNA"
                     /isolate="rEmyOrb1"
                     /db_xref="taxon:82168"
                     /chromosome="1"
                     /sex="male"
                     /tissue_type="blood"
                     /dev_stage="adult"
                     /geo_loc_name="Italy: Reserve Naturale Monte Rufeno"
                     /lat_lon="42.78473 N 11.88612 E"
                     /collection_date="2019-08-01"
                     /collected_by="Claudio Ciofi"
     gene            1..3036
                     /gene="ATP7B"
                     /note="ATPase copper transporting beta; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 4 Proteins"
                     /db_xref="GeneID:135877508"
     CDS             7..3036
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X1"
                     /protein_id="XP_065259036.1"
                     /db_xref="GeneID:135877508"
                     /translation="
MKQNFAFDNIGYEGSAENMPSLLPQTSTVTVNILGMTCQSCVQSIEGRISKVKGIVSIKISLEQSNAVIKYIQSEIGLQEICQEIGEMGFDANIAEGRTTASSVRSTSLGEALMKLRVEGMTCQSCVNIIEGKIGKLHGVLRIKVSLSNQEAVIAYQPYIIQPEDLKNHIDNLGYESTIKSKLAPLKLGMIDIERLQTTSTKKTPASLNNSNVEPVVGKMNSTTTMTLGVEGMHCKSCVKNIEGNISGLPGVRSIKVSLEHKNAVVQFNPNVITPVSLQQAIEALPPGNFKVSLPNGVEANNGELLSKAAFSSPQFRSTSSGDQLTSTSVLSIDGMTCGSCVQSIEGTMSQRKGVQHISVSLAERTGTIRYNSAVTNSEELRGAIEDMGFDASILTGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLLVWITIGFINFDVVQKYFPHQNKHLSKAEVILRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRMLLLGDMAKLSLKKVLAIVGTAEASSEHPLGMAVTKYCKEELGTESLGYCTDFQAVPGCGISCKVRSVEAVLGQSEQSVNEQNAYLSSVSTISLGHSSSIMVSESDAAPLTYSVLIGNREWMRRNGLLISSDVNDAMTGHEMKGQTAILVAIDGALCGMIGIADTVKQEAALAVHTLQNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNEGKKVAMVGDGVNDSPALAGADIGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLVLALIYNLLGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPGTERYEAKAQGHMKPLTPSQISVHIGMDDRRRDSPRPTAWDQISQVSLSSLTSNKLPGHGGFREEEGGKWSLLANDRDEEQYI"
ORIGIN      
ccagtcatgaagcagaattttgcctttgacaacatcggctacgaggggagcgctgaaaatatgccctctctgcttcctcaaacgagcaccgtcacagtcaatattttgggtatgacttgccagtcttgtgtgcagtcgatagagggcagaatttctaaggtgaagggcattgtgagcatcaagatctcccttgagcagagcaatgctgtaataaaatatatacagtcagaaataggtctccaagagatttgccaggaaattggagaaatgggctttgatgccaacattgcagaaggaagaactacagcatcatctgtaagatcgacgtccttgggagaagcactaatgaagctgcgggtagaaggtatgacatgccaatcttgtgtcaacatcatcgaaggaaagattggaaaactacatggtgtcctgagaatcaaagtctccctcagtaaccaagaagcagtcattgcttaccagccttacatcattcaacctgaagacctcaaaaaccacatagataacctggggtatgaaagcacgattaagagcaagctagccccattaaagcttggtatgattgatatagaacgcttgcagactacaagcacaaagaaaactccagccagcctgaacaatagcaatgtggagccagtggtgggcaaaatgaatagtacaacaactatgacactgggagtagaagggatgcactgcaagtcttgcgtcaaaaacatcgaaggaaatatatcaggtcttccaggcgtacgcagtattaaagtgtcattggaacataaaaatgctgttgtgcaatttaacccaaacgtaattaccccagtatctttgcaacaagccattgaggcccttccacctggtaactttaaagtatccctccctaatggagtggaagcaaataacggagagcttttatcaaaggcagcgttttcatcacctcagtttcgtagcacgtcctctggggatcagctgacaagcacatctgtacttagtattgatggaatgacctgtggatcctgtgtacagtccatagaaggcacaatgtcccaaaggaaaggggtacaacatatatcagtttcgttagctgaaaggactggaaccatacgctacaattcagctgtaactaattcagaagagctaagaggtgctatagaagacatgggatttgatgcttccattcttacaggggaagccatgccagtcactaaaaaacctgggagcacagtgattgcaggttctataaatgcacatggctcagttcttgttaatgcaactcacgttgggtctgacaccaccctggcacaaattgtgaaattggtagaagaagctcagatgtcaaaggcacccatccagcaattggctgataagtttagtggatattttgttccatttatcatcatcatttcaacagtgacattgctagtgtggatcacaattggctttataaactttgatgttgttcagaaatacttccctcatcagaacaaacacctctcaaaagctgaagtaatactgaggtttgcatttcaaacctcaatcactgtgctgtgcattgcatgcccctgttccttgggcttggctactccaacagctgtgatggtgggcacaggcgttgctgcccagaatggtattctcatcaaaggtggaaaacctctggaaatggcccacaagataaagactgtgatgttcgataaaaccgggaccatcacctgtggcgttcctaaagtcatgaggatgctcttgctaggggacatggctaagctgtctctaaagaaggtacttgcaattgtcggcactgcagaagccagcagtgagcatcccttaggaatggctgtcactaaatactgtaaagaggaacttggcacggagagcctgggatactgcacagattttcaggcagtcccaggctgtggaatcagctgtaaagtccgcagtgtggaagctgtactgggccagagtgagcagagtgtgaacgagcagaatgcttacctgagcagtgtcagcacgatttcgctgggacacagttcatcgatcatggtctctgaatctgatgcagcccctctgacatactcagtgctgattggaaatcgtgaatggatgagacggaacggcttgcttatatccagtgatgttaatgatgcaatgacaggccatgaaatgaaaggacagacagccatattggtggctatagatggtgcgttgtgtggaatgatcgggatagcagatactgtcaaacaggaggcagcgcttgctgtgcacaccctgcaaaatatgggaatagatgtggtgctaataacaggggacaacagaaaaactgcaaaagcaattgctactcaggttggcatcaaaaaggtctttgctgaggttctgccctctcacaaagttgcgaaggttcaggaactccagaatgaagggaagaaggttgctatggttggagatggagtcaacgattccccggcattggctggagcggacattggcattgctattggaacaggcacggatgttgccattgaagctgcagacgttgttcttattcgaaatgacttactggatgtggtggctagtattcatctatcaaagaggacagtaagaagaatacgaataaatctggtccttgccttaatttataatctgcttgggatacctatagcggcaggggtgttcatgcctattggaattgtgctgcagccctggatggggtcagctgcaatggcagcttcttcagtatctgtggtgctatcttccctgcaactgaaatgctacaagaagccaggaactgaaaggtatgaagcaaaagctcaaggccacatgaagccactgacaccttcccaaatcagtgttcacattgggatggacgacaggaggcgcgattcacccaggccaactgcctgggatcagattagtcaagtgtctctctcttctctgacttcaaacaagctgcccggacatggcggttttagagaggaagaaggtggcaagtggtcactgctcgctaatgacagagatgaagaacagtacatttaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]