GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-05 07:28:06, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_063611139            3040 bp    mRNA    linear   PRI 17-JUL-2024
DEFINITION  PREDICTED: Symphalangus syndactylus nuclear factor kappa B subunit
            1 (NFKB1), transcript variant X6, mRNA.
ACCESSION   XM_063611139
VERSION     XM_063611139.1
DBLINK      BioProject: PRJNA946760
KEYWORDS    RefSeq.
SOURCE      Symphalangus syndactylus (siamang)
  ORGANISM  Symphalangus syndactylus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hylobatidae; Symphalangus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_072432) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_028878055.3-RS_2024_07
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 07/16/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3040
                     /organism="Symphalangus syndactylus"
                     /mol_type="mRNA"
                     /isolate="Jambi"
                     /db_xref="taxon:9590"
                     /chromosome="10"
                     /sex="male"
                     /cell_line="Jambi"
                     /cell_type="lymphoblastoid"
                     /tissue_type="blood"
     gene            1..3040
                     /gene="NFKB1"
                     /note="nuclear factor kappa B subunit 1; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 13 long SRA reads"
                     /db_xref="GeneID:129492054"
     CDS             32..2959
                     /gene="NFKB1"
                     /codon_start=1
                     /product="nuclear factor NF-kappa-B p105 subunit isoform
                     X5"
                     /protein_id="XP_063467209.1"
                     /db_xref="GeneID:129492054"
                     /translation="
MAEDDPYLGRPEQMFHLDPSLTHTIFNPEVFQPQMALPTADGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNIHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLAYLQAEGGGDRQLGDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGGTGSTGPGYSFPHYGFPTYGGITFHPGTTKSNAGMKHGTMDTESKKDPEGCDKSDDKNTVNLFGKVIETTEQDREPSEATNGNGEVTLTYATGTKEESAGIQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDGVLHLAIIHLHSQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQEDVVEDLLRAGADLSLLDRLGNSVLHLAAKEGHDKVLSILLKHKKAALLLDHPNGDGLNAIHLAMMSNSLPCLLLLVAAGADVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWENAGEDEGVVPGTTPLDMATSWQVFDILNGKPYEPEFTSDDLLAQGDMKQLAEDVKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVRELVEALRQMGYTEAIDVIQAASSPVKTTSQAHSLPLLPASTRQQIGKEKRQKTVDIFSSSPRLVSSAVFGYGVAVFFLVFWIHFSVCLSTPWAHPLPLLIVLFR"
     misc_feature    158..763
                     /gene="NFKB1"
                     /note="N-terminal sub-domain of the Rel homology domain
                     (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region:
                     RHD-n_NFkB1; cd07935"
                     /db_xref="CDD:143651"
     misc_feature    order(200..202,206..211,215..220,227..238,461..463,
                     467..472,761..763)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143651"
     misc_feature    782..1087
                     /gene="NFKB1"
                     /note="IPT domain of the transcription factor NFkappaB and
                     related transcription factors. NFkappaB is considered a
                     central regulator of stress responses, activated by
                     different stressful conditions, including physical stress,
                     oxidative stress, and exposure to...; Region:
                     IPT_NFkappaB; cd01177"
                     /db_xref="CDD:238582"
     misc_feature    order(785..787,791..799,803..811,929..937,974..976,
                     1010..1012,1067..1069,1076..1078,1082..1084)
                     /gene="NFKB1"
                     /note="ankyrin protein binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238582"
     misc_feature    order(791..796,800..802,839..841,845..847,851..853,
                     950..955,962..964,968..970)
                     /gene="NFKB1"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238582"
     misc_feature    order(854..856,860..862,953..958)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238582"
     misc_feature    1520..2308
                     /gene="NFKB1"
                     /note="Ankyrin repeat [Signal transduction mechanisms];
                     Region: ANKYR; COG0666"
                     /db_xref="CDD:440430"
     misc_feature    order(1658..1660,1664..1666,1676..1681,1688..1696,
                     1700..1705,1715..1717,1724..1726,1769..1771,1775..1777,
                     1781..1783,1793..1798,1805..1813,1817..1822,1832..1834,
                     1841..1843,1868..1870,1874..1876,1880..1882,1892..1897,
                     1904..1912,1916..1921,1931..1933,1940..1942)
                     /gene="NFKB1"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    1658..1771
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1775..1870
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1982..2074
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2084..2182
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2477..2704
                     /gene="NFKB1"
                     /note="Death domain of the Nuclear Factor-KappaB1
                     precursor protein p105; Region: Death_NFkB1_p105; cd08797"
                     /db_xref="CDD:260063"
     polyA_site      3040
                     /gene="NFKB1"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
cgtgatagaactcttaaatttcaacttcagaatggcagaagatgatccatatttgggaaggcctgaacaaatgtttcatttggatccttctttgactcatacaatatttaatccagaagtatttcaaccacagatggcactgccaacagcagatggcccataccttcaaatattagagcaacctaaacagagaggatttcgtttccgttatgtatgtgaaggcccatcccatggtggactacctggtgcctctagcgaaaagaacaagaagtcttaccctcaggtgaaaatctgcaactatgtgggaccagcaaaggttattgttcagttggtcacaaatggaaaaaatatccacctgcatgcccacagcctggtgggaaaacactgtgaggatgggatctgcactgtaactgctggacccaaggacatggtggtcggcttcgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacgaatgacagaggcgtgtataaggggctataatcctggactcttggtgcaccctgaccttgcctatttgcaagcagaaggtggaggggaccggcagctgggagatcgggaaaaagagctaatccgccaagcagctctgcagcagaccaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttccggatagcactggcagcttcacaaggcgcctggaacccgtggtatcagacgccatctatgacagtaaagcccccaatgcatccaacttgaaaattgtaagaatggacaggacggctggatgtgtgactggaggggaggaaatttatcttctctgtgacaaagttcagaaagatgacatccagattcgattttatgaagaggaggaaaatggtggagtctgggaaggatttggggatttttcccccacagatgttcatagacaatttgccatcgtcttcaaaactccaaagtataaagatgttaatattacaaaaccagcctctgtgtttgtccagcttcggaggaaatctgacttggaaactagtgaaccaaaacctttcctctactatcctgaaatcaaagataaagaagaagtgcagaggaaacgtcagaagctcatgcccaatttttcggatagttttggcggtggtagtggcgccggagctggaggcggaggcatgtttggtagtggcggtggaggagggggcactggaagtacaggtccagggtatagcttcccgcactatggatttcctacttatggtgggattaccttccatcctggaactactaaatctaatgctgggatgaagcatggaaccatggacactgaatctaaaaaggaccctgaaggttgtgacaaaagtgatgacaaaaacactgtaaacctctttgggaaagttattgaaaccacagagcaagatcgggagcccagcgaggccaccaatgggaatggtgaggtcactctaacgtatgcaacaggaacaaaagaagagagtgctgggattcaggataacctctttctagagaaggctatgcagcttgcaaagaggcatgccaatgcccttttcgactacgcggtgacaggagacgtgaagatgctgctggccgtccagcgccatctcactgccgtgcaggatgagaatggggatggtgtcttacacttagcaatcatccaccttcattctcaacttgtgagggatctactagaagtcacgtctggtttgatttctgatgacattatcaacatgagaaatgatctgtaccagacgcccttgcacttggcagtgatcactaagcaggaagatgtggtggaggatttgctgagggctggggccgacctgagccttctggaccgcttgggtaactctgttttgcacctagctgccaaagaaggacatgataaagttctcagtatcttactcaagcacaaaaaggcagcactacttcttgaccaccccaacggggacggtctgaatgccattcatctagccatgatgagcaatagcctgccatgtttgctgctgctggtggccgctggggccgacgtcaatgctcaggagcagaagtccgggcgcacagcactgcatctggctgtggagcacgacaacatctcattggcaggctgcctgctcttggagggtgatgcccatgtagacagtactacctacgatggaaccacacccctgcatatagcagctgggagagggtccaccaggctggcagctcttctcaaagcagcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaatgcaggagaggatgaaggagttgtgcctggaaccacgcctctagatatggccaccagctggcaggtatttgacatattaaatgggaaaccatatgagccagagtttacatctgatgatttactagcacaaggagacatgaaacagctggctgaagatgtgaagctgcagctctataagttgctagaaattcctgatccagacaaaaactgggctactctggcgcagaaattaggtctggggatacttaataatgccttccggctgagtcctgctccttccaaaacacttatggacaactatgaggtttctggggggacagtcagagagctggtggaggccctgagacaaatgggctacaccgaagcgattgacgtgatccaggcagcctccagcccagtgaagaccacctctcaggcccactcattgcctctcttgcctgcctccacaaggcagcaaataggtaaagaaaaaagacaaaagacagtggacatattttccagctcccccaggctggtgtcttcagctgtctttggatatggtgtggcagttttctttctcgtcttctggatacacttctctgtgtgtctgtctaccccctgggctcaccctctgcctctcttgatagtactattcagatgagggggccgtgcccttggaaaatcacattgtcatatgaattacttagtaaacactaaataatacaataaatactaaaaacaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]