2024-04-29 07:31:57, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_056948580 2832 bp mRNA linear PLN 06-JUN-2023 DEFINITION Penicillium hispanicum uncharacterized protein (N7459_009412), partial mRNA. ACCESSION XM_056948580 VERSION XM_056948580.1 DBLINK BioProject: PRJNA973687 BioSample: SAMN30185340 KEYWORDS RefSeq. SOURCE Penicillium hispanicum ORGANISM Penicillium hispanicum Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspergillaceae; Penicillium. REFERENCE 1 (bases 1 to 2832) AUTHORS Petersen,C., Sorensen,T., Nielsen,M.R., Sondergaard,T.E., Sorensen,J.L., Fitzpatrick,D.A., Frisvad,J.C. and Nielsen,K.L. TITLE Comparative genomic study of the Penicillium genus elucidates a diverse pangenome and 15 lateral gene transfer events JOURNAL IMA Fungus 14 (1), 3 (2023) PUBMED 36726175 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 2832) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (06-JUN-2023) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 2832) AUTHORS Petersen,C. TITLE Direct Submission JOURNAL Submitted (04-JAN-2023) Department of Chemistry and Bioscience, Aalborg University, Fredrik Bajers Vej 7H, Aalborg, Nordjylland 9220, Denmark COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_026623200). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..2832 /organism="Penicillium hispanicum" /mol_type="mRNA" /strain="IBT 35686" /culture_collection="IBT:35686" /db_xref="taxon:1080232" /chromosome="Unknown" gene <1..>2832 /locus_tag="N7459_009412" /db_xref="GeneID:81638832" CDS 1..2832 /locus_tag="N7459_009412" /note="Argonaute linker 1 domain; Argonaute linker 2 domain; N-terminal domain of argonaute; PAZ domain; Piwi domain" /codon_start=1 /product="uncharacterized protein" /protein_id="XP_056795805.1" /db_xref="GeneID:81638832" /translation="
MSQPRGRGGAPRGNFRGGGGFSGRGGRGGYGGAGRGAPSGPNLMFQDVPVIDNAIQAFEDQCVQQNKSAPLQEKELVRRPGYGVQGRKIILRANFFSLDFSPNAPGFYCHKVVIKPEPSPRRHARQLFEQLMRTEEIAPLGAATDGSTEIVCTTKIVFNPRDFTVDKKDNGGGKSYRISLNEPELIKHVDLVSALKNAKPTGSSAFENAAIRALNILMTGAPSKDLGVVIKGKGCKFFWTDNRKQVADLKGGLECIRGFFSSIRPAAGRVLINMNTNHSAFYRPGPLFWLLGDFNDVFGKDNILLNRYIRGVRVELTHLPLQTKDDGSQGLRQKSIWGLASPRDGSRTENPPRVPHLGANADLVEFYMEEHNTGKGRYISVTDYYKKTYNMVLKNRTMPVVNVGSSDKPTYLPADVCKILPGQIYNGELGTTQRQNIINFSCRRPPDNFNSINSDGMKIMGVTDTRTQKFGIQVNPGMVAVPGRILNPPSLKYGTTWQVPSKGSWNLVGKKFCEGAVIKSWTGVLLQKKGFSLPGSNTTTPELNRALEKFWTCAKNLGISWPKPSPCAFLGFERDQMHERVDEMFRKAATHLSFIVVLLPMQEDRVFNYIKWVGDTRAGILTHCCSASKFLQGNDQYLANNAMKVNLKMGGICQSLEMPQSSRLLNAGKTMVVGLDVTHPSPTDTEAFPSIACIVASIDSRVGQWPGEARIQMRRVETIQPLQAMMGNCLERWVKKNKQLPLNILIYRDGVSEGQYQMVLNEELKSIKTAAQLLYKGRPPNITIVVCGKRHNVRFFPTRESDADRTNNPLNGTVVDRVVTRPQLWDFYLQAQAPIQGSARPAHYVVIHDEIFTNPAANPDHMKPADTLQELTHNICYMMGRCTRSISYSTPAFLADKFCDRARKYVRAHFTKEMETRDSAALSTPPQSVVKLADQIIDSMVYI"
misc_feature 706..849 /locus_tag="N7459_009412" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 859..1260 /locus_tag="N7459_009412" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(1000..1002,1096..1098,1141..1143,1153..1155, 1207..1209,1228..1230,1234..1236) /locus_tag="N7459_009412" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1402..2715 /locus_tag="N7459_009412" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1819..1821,1831..1833,1867..1878,1885..1887, 1909..1911,1918..1920,1930..1932,1942..1944) /locus_tag="N7459_009412" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(2026..2028,2032..2034,2245..2247,2686..2688) /locus_tag="N7459_009412" /note="active site" /db_xref="CDD:240015" ORIGIN
atgtctcagcctcgtggacgtggaggagcccctcggggcaatttccgtggcggcggtggtttttctggccgtggaggacgtggaggctacggcggcgccggtcgtggtgctccatcaggccccaacctgatgtttcaggatgttcctgtcatcgacaatgcgatccaagccttcgaggaccaatgtgttcagcagaacaaaagtgcccctctccaggagaaggagctggtccgacgcccgggttatggtgttcagggacggaagattatcctgcgcgccaacttcttcagtcttgacttcagcccaaatgctccaggtttctactgtcataaagtagtcatcaagcccgaaccatctccccggcgacatgcgaggcagctgttcgagcaactcatgcggactgaagagattgctccgcttggtgctgctaccgatggtagcactgagattgtctgcaccaccaagattgtcttcaaccctcgtgattttacggttgataagaaagacaacggtggaggcaaatcgtaccggatttccttgaatgagccagagctcatcaaacatgtggacttggtttcagcgctgaagaatgcgaaaccaacgggctcttctgccttcgaaaatgccgccattcgagctttgaacattctgatgaccggtgccccttcgaaggatctcggcgtcgttatcaaaggaaagggctgcaagttcttttggaccgacaatcgaaagcaggtcgccgatctcaagggcggactcgagtgcatccggggcttcttttcaagcattcgccccgctgctggtcgagtgctgatcaatatgaacaccaaccacagcgctttctatcgccctggtcccttgttttggttgctcggtgactttaacgacgtgtttgggaaggacaacattctcttgaaccgctatattcgcggtgtccgcgttgagctgacccatctgcctcttcaaacaaaggacgacggatcacagggccttcgacagaagtctatctggggcctggcttcacctcgcgatggatctcgaaccgagaatccccctcgggttccgcaccttggggccaacgctgaccttgttgagttctacatggaggaacataacactggcaaaggtcgttacattagtgtcactgattactacaagaagacctataacatggtcctcaaaaaccgtactatgcctgtggtcaacgtgggaagttcggacaagccgacttatttgccagcagacgtttgcaaaatcctcccaggacaaatctacaacggtgagcttggaaccacgcagcgacagaacatcatcaatttcagttgccgccgtccaccagacaacttcaactccattaacagcgatgggatgaagatcatgggtgttactgatacccggacccaaaaatttgggatccaggtcaaccccggcatggttgcagttcctggacgcattctcaaccccccaagtctgaagtatggtactacatggcaggttcccagcaaaggcagttggaatcttgtgggaaagaagttctgcgaaggggccgtgatcaagagctggactggagtcctgctccagaaaaagggctttagtctgcctggaagcaacacgactacacccgagctgaaccgggcgcttgaaaagttctggacttgtgcgaagaacttgggtatttcctggcctaaaccgagtccttgtgcattcctggggttcgaaagagaccagatgcatgaacgagtcgatgaaatgttccgaaaggcggctacgcacctttccttcattgtggtcttgcttcccatgcaggaggaccgtgttttcaactacatcaaatgggtcggtgatactcgggctggcattctaacccactgttgctctgcctccaaattcctccaaggcaatgatcagtacctcgcaaacaatgccatgaaggtaaacctgaagatgggtggcatctgccagtccctggaaatgcctcagtcttctcgcctgttgaatgctggaaaaaccatggtcgtcggcctcgacgtcacacacccttctcctactgacactgaagcatttcctagcatcgcatgcatcgttgccagcattgattcccgcgtcggccagtggccgggcgaagctcgcatccaaatgcgccgcgttgagactatccagcctctccaagcgatgatgggaaattgcctagagcggtgggtcaagaagaacaagcagctcccgctcaacatcctcatctaccgggatggcgtcagcgaaggccaataccagatggtcctgaatgaagaactgaagtccatcaagaccgcagcgcagctcctgtacaagggtcgcccgcccaacatcaccatcgtcgtctgcggcaaacgtcacaacgtccgctttttcccaacccgagaatccgatgctgaccgcactaacaacccactcaacggaaccgtcgtggaccgagttgtcactcgtccgcagctgtgggatttctatctccaggcacaggcgcctattcagggatccgctcgaccggctcactacgttgtcattcatgacgagatctttaccaaccctgctgctaacccagaccacatgaagcccgccgacacgctccaggaactgacccacaacatctgctacatgatgggccgctgcactcgctcgatctcctacagcactcccgccttcctcgccgacaagttctgtgaccgcgcgcgcaagtacgtgcgtgctcacttcaccaaggaaatggaaacccgcgacagcgccgccctgtccactcctcctcagagtgtggttaagctggctgaccagatcatcgatagcatggtctatatctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]