2024-05-03 00:07:31, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_056141410 2834 bp mRNA linear INV 18-MAY-2023 DEFINITION PREDICTED: Ostrea edulis protein argonaute-2-like (LOC125683714), transcript variant X10, mRNA. ACCESSION XM_056141410 VERSION XM_056141410.1 DBLINK BioProject: PRJNA970818 KEYWORDS RefSeq. SOURCE Ostrea edulis ORGANISM Ostrea edulis Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Bivalvia; Autobranchia; Pteriomorphia; Ostreida; Ostreoidea; Ostreidae; Ostrea. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_079169) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_947568905.1-RS_2023_05 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 05/10/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2834 /organism="Ostrea edulis" /mol_type="mRNA" /db_xref="taxon:37623" /chromosome="6" gene 1..2834 /gene="LOC125683714" /note="protein argonaute-2-like; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 86 long SRA reads" /db_xref="GeneID:125683714" CDS 120..2819 /gene="LOC125683714" /codon_start=1 /product="protein argonaute-2-like isoform X10" /protein_id="XP_055997385.1" /db_xref="GeneID:125683714" /translation="
MFPIAPGSTPLSFGPFTTVPPPEPPPHPADQPPPTPIPPSNGNAGEFVCPLRPDHGREGKPIALRANHFHVNIPKGFIHHYNIAIVPEKCPRRVNREIVETMVNAYTPRIFSGQKPVFDGREKMYSREPLPFGKDKVELEVTLPGEGRDRVFKVAIKWVSQISLYALEEALEGRARRIPECAVEALDVIMRHLPSMMYTPVGRSFFSPPEDYDYPLGGGREVWFGFHQSVRPSHWKMMLNIDVSATAFYKAQPVIDFMCEILELKDANEQRRPLTDSQRVKFTKEIRNLKVEITHCGTMRRKYRVCNVTRRPAQTQSFPLQLDSGQTVDCTVARYFLERYKMKLLHPHLPCLQVGQEHKHTYLPLEVCNVVGGQRCIKKLTDLQTSTMIRATAKNAPDREKEINNLVKKANYNADPHLRTFGITVNPQMMDLHGRVLSHPKLQYGGAVSAGRESDKETKAQALPNQGVWDMRGKQFYFGIEVRVWAIACFAPQRSVREDALRNFTQQLQKISTDAGMPILGQPCFCKYATGPDQVEPMFRYLKNTYAGLQLIVVVLPGRTPVYAEVKRVGDILFGLATQCVQSKNVNKTSPQTLSNLCLKINVKLGGINNILLPSSRPLVFREPVIFLGADVTHPPAGDTSKPSIAAVVGSMDAHPSRYSATVRVQEHRKEVIEEFCSMVRELLISFYKSTQFKPTRIIIYRDGVSEGQFQKVLAHELRAVREACMKLEIGYQPGITFIAVQKRHHTRLFCADRKDQIGRSGNIPAGTTVDVGITHPTEFDFYLCSHAGIQGTSRPSHYHVLFYLQGTSRPSHYHVLFYLQGTSRPSHYHVLFYLQGTSRPSHYLVLFYLQGTSRPSYYHVLLYLQGTSRPSHYHVLLYLQGTSRPSHYHVLLYLQGTS"
misc_feature 297..689 /gene="LOC125683714" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:435368" misc_feature 717..869 /gene="LOC125683714" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 870..1232 /gene="LOC125683714" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(1026..1028,1071..1073,1113..1115,1125..1127, 1179..1181,1200..1202,1206..1208) /gene="LOC125683714" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1365..2525 /gene="LOC125683714" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1806..1808,1818..1820,1854..1865,1872..1874, 1896..1898,1905..1907,1917..1919,1929..1931) /gene="LOC125683714" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" ORIGIN
gcacagaagatcaccaagaaagagtgcgccatgttttattttttgacaaaaagatggaaatgacagaactttgtttacgtcttctgatttaccatttcccttcgtcataagatgtcataatgtttcccatagcaccagggtccaccccgctttcctttggtccgttcaccacagtccctccacctgaaccaccaccccaccctgctgaccagccacccccaaccccaataccaccatccaatggaaatgcaggagaatttgtctgtcccctcaggccagaccatggacgggagggaaagcctattgctctccgagcaaatcatttccatgtcaacatccctaaggggttcatccaccactacaacattgcaattgtacctgagaaatgtcccaggagggtcaacagagagatagtagagacaatggtgaatgcctacacacccagaattttctcaggacaaaagcctgtttttgatggcagagagaaaatgtacagccgggaaccactcccgtttggcaaagacaaggtggaacttgaggtcactctgccaggagaggggcgtgaccgcgtgttcaaggttgccattaagtgggtatcacagataagtctgtacgccctggaggaggccttagagggacgcgcacggagaatccccgagtgtgcggtggaagccctcgatgtcatcatgagacacctacccagcatgatgtacacccctgttgggcggtcctttttctcacccccagaggactatgactacccactaggagggggtcgggaggtctggtttggcttccatcagagtgttcgtccctcccactggaaaatgatgctgaatattgatgtgtcagcgacagctttttataaagcccagccagtcatagacttcatgtgtgagattttggagctgaaggatgccaacgaacagaggcgacctctgacagattcacaaagagttaaattcaccaaggaaattagaaatttgaaggtagagatcacacactgtggaaccatgaggagaaaataccgtgtgtgtaatgttacccgccgtcctgctcaaactcagtcatttccgctccagctcgactcgggacagacggttgattgtacggtagccaggtactttctggagcggtacaagatgaaattgctgcatccccacttgccatgtctacaagttggacaagaacataagcacacatatcttcctttagaggtttgtaatgttgttggaggtcaaagatgtataaagaaattgacagatcttcaaacatccaccatgatcagggcaacagcaaagaatgctcctgacagagaaaaagaaatcaataatttggttaaaaaagcaaattacaatgctgatccccacctgaggacgttcggaatcacggtcaacccccaaatgatggacctacacggtcgcgttctgtctcatcccaagctacaatatggaggcgcggttagtgcaggacgggagtctgataaagagactaaagcccaagctctgccaaaccagggggtatgggatatgagggggaagcagttctacttcgggattgaggtgcgagtgtgggccattgcatgctttgcccctcagaggagtgttagggaagatgcactgagaaattttacccagcagttacagaaaatttctacagatgcaggaatgcccattttgggccagccctgtttctgcaaatatgccactgggccagaccaagtggaaccaatgtttcgttacctgaagaacacatatgctgggctacagctcattgtggtggttctaccaggcagaacaccagtttacgctgaggttaagcgagtaggagacatcttgtttggcttagctacacagtgcgtgcagtccaaaaatgtaaacaaaacgtctccccagacgctctccaacctctgcctgaaaattaacgtcaagttaggcggcatcaacaatatcctactgccaagttccagacccctggtgtttcgagaaccagtgattttcctcggagcagacgtgactcatccccctgctggagacacaagcaaaccttccatagcagctgtggtaggtagtatggatgcccaccccagtcgttactctgcaactgtcagggtccaggaacaccgtaaggaggtgatcgaggagttctgctcaatggtccgtgaacttctcatctccttctacaagtccacacaattcaagccaacccgcatcatcatttacagggatggcgtcagcgaagggcagtttcaaaaggtacttgcacatgagctgagagcagtaagggaggcttgtatgaagctggagataggttaccagcccgggataaccttcattgctgtccagaaacggcaccacaccagactcttttgtgccgataggaaggaccagatagggcgcagtgggaacatcccagcaggaaccacagtggatgttgggatcacacaccccacagaattcgacttttacctatgcagtcacgctggaatacagggcacaagtcgaccgtctcattaccatgtgttgttttatttacagggcacaagtcgaccgtctcattaccatgtgttgttttatttacagggcacaagtcgaccgtctcattaccatgtgttgttttatttacagggcacaagtcgaccgtctcattaccttgtgttgttttatttacagggcacaagtcgaccgtcttattaccatgtgttgttatatttacagggcacaagtcgaccgtctcattaccatgtgttgttatatttacagggcacaagtcgaccgtctcattaccatgtgttgttatatttacagggcacaagttgaccgtctcattacctt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]