2024-04-25 01:05:21, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_048175608 2353 bp mRNA linear VRT 13-MAY-2022 DEFINITION PREDICTED: Megalobrama amblycephala vimentin-related 2 (vimr2), mRNA. ACCESSION XM_048175608 VERSION XM_048175608.1 DBLINK BioProject: PRJNA835491 KEYWORDS RefSeq. SOURCE Megalobrama amblycephala (Wuchang bream) ORGANISM Megalobrama amblycephala Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Xenocyprididae; Xenocypridinae; Megalobrama. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_063066) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Megalobrama amblycephala Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2353 /organism="Megalobrama amblycephala" /mol_type="mRNA" /isolate="DHTTF-2021" /db_xref="taxon:75352" /sex="female" /tissue_type="blood" /linkage_group="LG23" gene 1..2353 /gene="vimr2" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 5 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 11 samples with support for all annotated introns" /db_xref="GeneID:125258663" CDS 194..1363 /gene="vimr2" /codon_start=1 /product="desmin" /protein_id="XP_048031565.1" /db_xref="GeneID:125258663" /translation="
MALLRVSSYRKLFEEEQWSQAAGRCGVQARSAARGRVSVSECPELDFAAARALNKEGVARFVHERSVIAALNDRLAGLIDVVRCLEEENESLEAEIIELEERLESEQITTTTVSISGPVDYSLEAVIERLRKEKEEILCNTEELKGELRRLQMKYDQVVEHKTLIQQEREDVSLEVDVITTDCLALREQVAIYEEQLAAMERQHEMRLEKLCEPRPLDEGSPTVTVQFPAFDITPAIMDIKEFYSELAESLKFEPRASSAAAIDAAGKEKEEQLAKLTGGKVKDVSKETDVNVLKNLIAELQKEVAELEKRGDELEAEIEAKEAKYLEDIEELENYICQLEEEEADLQFQMKDQTGDYEELLNQKMNLEIEIAAYRGLVEEEVERLSCL"
misc_feature 383..1348 /gene="vimr2" /note="Intermediate filament protein; Region: Filament; pfam00038" /db_xref="CDD:425436" polyA_site 2353 /gene="vimr2" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
ctcctatcatgctgcagtggctgaattgtttctgttccatgcgaaaggtttatcttctgacactcttcccttagttagtctattttgtgttcagtgagagatcccacaggtgtgtgtgacattctcagtccgacgtctatatagacccccggcttgtgcggctgtcatcttcttttgctttcctgctgctgtcatggccctgctgagagtgtcatcgtaccgtaagctgtttgaggaggagcagtggagccaggctgcaggacgctgtggagtccaggcccgctccgctgccaggggtagagtttcagtgagtgaatgtcccgagctggattttgccgcagctcgtgccctaaacaaagagggtgtggctcgatttgtccatgagcgctctgtcatcgctgccctcaacgatcgcctggccggcctcatcgatgtggttcggtgtctagaagaggagaatgaatctctggaggctgaaatcattgagctggaagagaggctagagtcagagcagatcaccacaaccaccgtcagcatcagtggccctgtcgactacagtctggaggctgtgatagagaggctacggaaagaaaaggaggagattttatgcaacacggaggagctgaagggtgagctgcggcgtctgcagatgaaatatgatcaggtggttgagcacaagactctcatccagcaagagcgagaagatgtttctttggaggtggatgtaattaccactgactgcctagcccttcgagagcaagtggccatctatgaggagcagcttgctgccatggagaggcagcatgaaatgcggctggagaagctgtgtgaacccaggcctctggatgaaggttctccaactgtaactgtgcagttccccgcctttgatatcactccagccatcatggacatcaaggagttctacagcgagctggctgagagcctcaagtttgagcccagagcctcaagcgctgccgccattgatgccgcaggaaaggagaaggaggagcagctggctaagttgactggagggaaagtgaaggacgtctccaaagagactgatgtgaatgtcctcaagaacctgattgcagagctgcagaaagaggtggcagagctggagaagcgtggagacgagttggaggctgaaatagaagctaaggaagccaaatacctggaggatatagaggagctggagaattacatttgtcagctggaggaggaggaggctgatcttcagttccagatgaaggatcaaactggggactatgaagaactgctgaatcagaagatgaatctagaaatagagattgctgcttataggggtttggttgaagaagaggtggagagactgagctgcctgtaagatgcgagaagaggtgatgctcttctctggactgaagcaaacacaaagaaacactaaaaccacataaagttcaacccttaacaatgagtctcacaaatcaagaaagtaaagaaaacagctgtcagacacacttaaccttctgagcagatgtaaaccttcactgacagatgaacttcagggagtttgtgcaagctcattgataacgggtcagtggcaggtaacccggggtcttcaagaaacactggatctgtgcagcagtgggagtgttgggggattttcagcacaggaatcttctgcttgcagttacatagtccatcactgataaacaaacatacactatatagttacaaagtttgaggtcagtaagatttatttttaaaataaattaatacttttattcagcaaggatgcattaaattgatcaaagttagaggcttctttcaaaaacattaaaaaactcttaccaacctcaaacttttgaatggtggtgtacgtttcattcacactttagagttttatcactctgcagatagagcctgatgatactcactttacctttaacctttcctgttctgtccaaaagctgttttagatctgtctataagtacatttacattaaaattttgatttcaatctgactacagaaataattcgtctttttaaaatgtttaagtctcaccagtctggttttgtaattcagactaagagaccttccagcatatgcattaaaaatgtattccttcaaatatgtaattatgcattgtgttgtgtactttgacagatagacttttgattggataaaaaacacatattgacagataaggtaactaaatttcccaaataactctagtgctccacattttcattgacttgttagactttttgcttatcccttatcatctgcagctagtttttaattgaacatacagtactgactctcttctgtgcaacaacttacagcatttaaataaatctttgcctttaaaatca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]