GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-25 01:05:21, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_048175608            2353 bp    mRNA    linear   VRT 13-MAY-2022
DEFINITION  PREDICTED: Megalobrama amblycephala vimentin-related 2 (vimr2),
            mRNA.
ACCESSION   XM_048175608
VERSION     XM_048175608.1
DBLINK      BioProject: PRJNA835491
KEYWORDS    RefSeq.
SOURCE      Megalobrama amblycephala (Wuchang bream)
  ORGANISM  Megalobrama amblycephala
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Xenocyprididae; Xenocypridinae; Megalobrama.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_063066) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Megalobrama amblycephala Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2353
                     /organism="Megalobrama amblycephala"
                     /mol_type="mRNA"
                     /isolate="DHTTF-2021"
                     /db_xref="taxon:75352"
                     /sex="female"
                     /tissue_type="blood"
                     /linkage_group="LG23"
     gene            1..2353
                     /gene="vimr2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 5 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 11 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:125258663"
     CDS             194..1363
                     /gene="vimr2"
                     /codon_start=1
                     /product="desmin"
                     /protein_id="XP_048031565.1"
                     /db_xref="GeneID:125258663"
                     /translation="
MALLRVSSYRKLFEEEQWSQAAGRCGVQARSAARGRVSVSECPELDFAAARALNKEGVARFVHERSVIAALNDRLAGLIDVVRCLEEENESLEAEIIELEERLESEQITTTTVSISGPVDYSLEAVIERLRKEKEEILCNTEELKGELRRLQMKYDQVVEHKTLIQQEREDVSLEVDVITTDCLALREQVAIYEEQLAAMERQHEMRLEKLCEPRPLDEGSPTVTVQFPAFDITPAIMDIKEFYSELAESLKFEPRASSAAAIDAAGKEKEEQLAKLTGGKVKDVSKETDVNVLKNLIAELQKEVAELEKRGDELEAEIEAKEAKYLEDIEELENYICQLEEEEADLQFQMKDQTGDYEELLNQKMNLEIEIAAYRGLVEEEVERLSCL"
     misc_feature    383..1348
                     /gene="vimr2"
                     /note="Intermediate filament protein; Region: Filament;
                     pfam00038"
                     /db_xref="CDD:425436"
     polyA_site      2353
                     /gene="vimr2"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
ctcctatcatgctgcagtggctgaattgtttctgttccatgcgaaaggtttatcttctgacactcttcccttagttagtctattttgtgttcagtgagagatcccacaggtgtgtgtgacattctcagtccgacgtctatatagacccccggcttgtgcggctgtcatcttcttttgctttcctgctgctgtcatggccctgctgagagtgtcatcgtaccgtaagctgtttgaggaggagcagtggagccaggctgcaggacgctgtggagtccaggcccgctccgctgccaggggtagagtttcagtgagtgaatgtcccgagctggattttgccgcagctcgtgccctaaacaaagagggtgtggctcgatttgtccatgagcgctctgtcatcgctgccctcaacgatcgcctggccggcctcatcgatgtggttcggtgtctagaagaggagaatgaatctctggaggctgaaatcattgagctggaagagaggctagagtcagagcagatcaccacaaccaccgtcagcatcagtggccctgtcgactacagtctggaggctgtgatagagaggctacggaaagaaaaggaggagattttatgcaacacggaggagctgaagggtgagctgcggcgtctgcagatgaaatatgatcaggtggttgagcacaagactctcatccagcaagagcgagaagatgtttctttggaggtggatgtaattaccactgactgcctagcccttcgagagcaagtggccatctatgaggagcagcttgctgccatggagaggcagcatgaaatgcggctggagaagctgtgtgaacccaggcctctggatgaaggttctccaactgtaactgtgcagttccccgcctttgatatcactccagccatcatggacatcaaggagttctacagcgagctggctgagagcctcaagtttgagcccagagcctcaagcgctgccgccattgatgccgcaggaaaggagaaggaggagcagctggctaagttgactggagggaaagtgaaggacgtctccaaagagactgatgtgaatgtcctcaagaacctgattgcagagctgcagaaagaggtggcagagctggagaagcgtggagacgagttggaggctgaaatagaagctaaggaagccaaatacctggaggatatagaggagctggagaattacatttgtcagctggaggaggaggaggctgatcttcagttccagatgaaggatcaaactggggactatgaagaactgctgaatcagaagatgaatctagaaatagagattgctgcttataggggtttggttgaagaagaggtggagagactgagctgcctgtaagatgcgagaagaggtgatgctcttctctggactgaagcaaacacaaagaaacactaaaaccacataaagttcaacccttaacaatgagtctcacaaatcaagaaagtaaagaaaacagctgtcagacacacttaaccttctgagcagatgtaaaccttcactgacagatgaacttcagggagtttgtgcaagctcattgataacgggtcagtggcaggtaacccggggtcttcaagaaacactggatctgtgcagcagtgggagtgttgggggattttcagcacaggaatcttctgcttgcagttacatagtccatcactgataaacaaacatacactatatagttacaaagtttgaggtcagtaagatttatttttaaaataaattaatacttttattcagcaaggatgcattaaattgatcaaagttagaggcttctttcaaaaacattaaaaaactcttaccaacctcaaacttttgaatggtggtgtacgtttcattcacactttagagttttatcactctgcagatagagcctgatgatactcactttacctttaacctttcctgttctgtccaaaagctgttttagatctgtctataagtacatttacattaaaattttgatttcaatctgactacagaaataattcgtctttttaaaatgtttaagtctcaccagtctggttttgtaattcagactaagagaccttccagcatatgcattaaaaatgtattccttcaaatatgtaattatgcattgtgttgtgtactttgacagatagacttttgattggataaaaaacacatattgacagataaggtaactaaatttcccaaataactctagtgctccacattttcattgacttgttagactttttgcttatcccttatcatctgcagctagtttttaattgaacatacagtactgactctcttctgtgcaacaacttacagcatttaaataaatctttgcctttaaaatca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]