2024-05-11 12:16:13, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_048061750 1805 bp mRNA linear VRT 09-MAY-2022 DEFINITION PREDICTED: Anser cygnoides vimentin (VIM), mRNA. ACCESSION XM_048061750 VERSION XM_048061750.1 DBLINK BioProject: PRJNA832243 KEYWORDS RefSeq. SOURCE Anser cygnoides (Swan goose) ORGANISM Anser cygnoides Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Anseriformes; Anatidae; Anserinae; Anser. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_025927682) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Anser cygnoides Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1805 /organism="Anser cygnoides" /mol_type="mRNA" /isolate="SCWG-2014" /db_xref="taxon:8845" /chromosome="Unknown" /tissue_type="hypophysis; hypothalamus; ovary" /breed="Sichuan white goose" gene 1..1805 /gene="VIM" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 37 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 81 samples with support for all annotated introns" /db_xref="GeneID:106030144" CDS 99..1481 /gene="VIM" /codon_start=1 /product="vimentin" /protein_id="XP_047917707.1" /db_xref="GeneID:106030144" /translation="
MSISSKNSSYRRMFGGGSRPGTSSRYVTSSSSRYSLGSSLRPSSARFVSASPGGMYATKATSVRLRSSMPPMRLHDAVDFTLADAINTEFKANRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGKGTSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLADDIMRLREKLQEEMLQREEAENTLQSFRQDVDNASLARLDLERKVESLQEEIVFLKKLHDEEIRELQAQLQEQHIQIDMDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQEANEYRRQIQSLTCEVDALKGSNESLERQMREMEENFALEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRINMPIPTFASLNLRETNIESQPMVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"
misc_feature 120..383 /gene="VIM" /note="Intermediate filament head (DNA binding) region; Region: Filament_head; pfam04732" /db_xref="CDD:428095" misc_feature 384..1310 /gene="VIM" /note="Intermediate filament protein; Region: Filament; pfam00038" /db_xref="CDD:425436" polyA_site 1805 /gene="VIM" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
gggccaccgcccttctcctcagagcctcgcctcgcctcagctccccgccggattacaaagcccgcttcttcttcttctccgccgccgccgctaccgccatgagcatcagcagcaagaactcctcgtaccgccgcatgttcggcgggggcagccggcccggcacgtcgagccgctacgtgacgagcagcagcagccggtactcgctgggcagctcgctgcgacccagcagcgcccgcttcgtgtccgcctcgcccggcggcatgtacgccaccaaggccacctcggtgcggctgcggagcagcatgccgcccatgcggctccacgacgccgtggacttcacgctggccgacgccatcaacacggagttcaaggcgaaccgcaccaacgagaaggtggagctgcaggagctcaacgaccgcttcgccaactacatcgacaaggtgcgcttcttggagcagcagaacaagatcctgctggccgagctggagcagctcaagggcaagggcacgtcccgcctgggcgacctgtacgaggaggagatgcgggagctgcgccggcaggtggaccagctcaccaacgacaaggcgcgggtggaggtggagcgggacaacctggccgacgacatcatgaggctgagggagaagttgcaggaggagatgctgcagcgggaggaggcggagaacaccctgcagtccttcaggcaggatgttgacaatgcctctctggcacgccttgatcttgagcgcaaagttgagtccctgcaagaagagattgtcttcttgaagaagcttcatgatgaggaaatccgagaactgcaggcccaactccaggaacagcacatccagattgatatggatgtttccaagcctgatcttactgctgccctgcgtgatgttcgccaacagtacgaaagcgttgctgctaagaatcttcaggaagctgaagagtggtacaagtccaaatttgcagatctctctgaagctgctaacaggaacaacgatgccctgcgtcaggccaaacaagaagctaatgaataccgcagacagattcagtctctcacctgcgaagttgatgcccttaaaggaagcaatgaatccctggagcgccagatgcgtgaaatggaggagaattttgctcttgaagctgctaactaccaagacactattggccgtctgcaggatgagattcagaacatgaaggaagaaatggctcgccatcttcgtgagtaccaggacctgctgaatgtaaagatggctcttgatattgagattgccacctacagaaaactgctggagggagaagagagcaggattaacatgcctattccaacctttgcttctttgaacctgagagaaaccaacattgagtctcagccaatggttgacactcactcaaagaggacacttctaattaagaccgtggaaactagagatggacaggttattaatgaaacttcccagcaccatgatgacttggagtaaagctgaagtgaagttgcaaacttagtgcaggagaaattcttaccagcaaggttttaaaaagtccatgtcttaaaggaagaaacagctttcaagtgcctttctgcagtttttccatgagcgcaagattattatgctaggaaataggtcttagatcttgcaaactgactctccctgaaggattagagtttacaatggagtctagtttacaaatagcaatatcttgtgctgcaatactgtttttaagtatctgaattcaataaaactgctttttccagcacagtatgagcaacctgtcgctacttcaataaatctttggaaaatggc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]