GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-05 07:59:24, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_047566733            3576 bp    mRNA    linear   ROD 04-MAR-2023
DEFINITION  PREDICTED: Sciurus carolinensis nuclear factor kappa B subunit 1
            (Nfkb1), transcript variant X4, mRNA.
ACCESSION   XM_047566733
VERSION     XM_047566733.1
DBLINK      BioProject: PRJNA823697
KEYWORDS    RefSeq.
SOURCE      Sciurus carolinensis (gray squirrel)
  ORGANISM  Sciurus carolinensis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
            Sciuromorpha; Sciuridae; Sciurinae; Sciurini; Sciurus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_062222) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_902686445.1-RS_2023_03
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 03/03/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3576
                     /organism="Sciurus carolinensis"
                     /mol_type="mRNA"
                     /db_xref="taxon:30640"
                     /chromosome="10"
     gene            1..3576
                     /gene="Nfkb1"
                     /note="nuclear factor kappa B subunit 1; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 8 Proteins, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 1 sample with
                     support for all annotated introns"
                     /db_xref="GeneID:124994613"
     CDS             80..2902
                     /gene="Nfkb1"
                     /codon_start=1
                     /product="nuclear factor NF-kappa-B p105 subunit isoform
                     X3"
                     /protein_id="XP_047422689.1"
                     /db_xref="GeneID:124994613"
                     /translation="
MPLPTDGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNIHLHAHSLVGKHCEDGICTVNAGPKDMVVGFANLGILHVTKKKVFETLEARMTDACVRGYNPGLLVHPDLAYLQAEGGGDRQLTDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGSTGTTGPGYGFPHYGFPTYGGITFHPGTTKSNAGLKHGTMNAESKSDPEDCDTRGGRETINLSGNVIKTTEQDKELGMSSDGNEEVTPTCTMGVKEEDARFQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHAQLVRDLLEVTSGLVSDDIINMRNDLYQTPLHLAVITKQEDVVEDLLSAGADLSLLDRLGNSVLHLAAKEGHDKVLSILLKHKKAALLLDHPNGEGLNAIHIAVMSNSLPCLLLLVAAGADVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTKLAALLKAAGADPLVENFEPLYDLDDSWEKAGEDEGVVPGTTPLDMATSWQVFDILNGKPYEPEFTSEDLLAQGDMKQLTEDAKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVKELVEALRQMGYTEAIEVIQAAFCTSEASSPVKTTSQAHSLPLLPSSTRQQIDELRDNDSICDSGVETSFRKLSFTESLTNSSSLLTLNKMPQDYGQEGPIEGKI"
     misc_feature    101..706
                     /gene="Nfkb1"
                     /note="N-terminal sub-domain of the Rel homology domain
                     (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region:
                     RHD-n_NFkB1; cd07935"
                     /db_xref="CDD:143651"
     misc_feature    order(143..145,149..154,158..163,170..181,404..406,
                     410..415,704..706)
                     /gene="Nfkb1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143651"
     misc_feature    725..1030
                     /gene="Nfkb1"
                     /note="IPT domain of the transcription factor NFkappaB and
                     related transcription factors. NFkappaB is considered a
                     central regulator of stress responses, activated by
                     different stressful conditions, including physical stress,
                     oxidative stress, and exposure to...; Region:
                     IPT_NFkappaB; cd01177"
                     /db_xref="CDD:238582"
     misc_feature    order(728..730,734..742,746..754,872..880,917..919,
                     953..955,1010..1012,1019..1021,1025..1027)
                     /gene="Nfkb1"
                     /note="ankyrin protein binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238582"
     misc_feature    order(734..739,743..745,782..784,788..790,794..796,
                     893..898,905..907,911..913)
                     /gene="Nfkb1"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238582"
     misc_feature    order(797..799,803..805,896..901)
                     /gene="Nfkb1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238582"
     misc_feature    1463..2251
                     /gene="Nfkb1"
                     /note="Ankyrin repeat [Signal transduction mechanisms];
                     Region: ANKYR; COG0666"
                     /db_xref="CDD:440430"
     misc_feature    order(1601..1603,1607..1609,1619..1624,1631..1639,
                     1643..1648,1658..1660,1667..1669,1712..1714,1718..1720,
                     1724..1726,1736..1741,1748..1756,1760..1765,1775..1777,
                     1784..1786,1811..1813,1817..1819,1823..1825,1835..1840,
                     1847..1855,1859..1864,1874..1876,1883..1885)
                     /gene="Nfkb1"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    1601..1714
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1718..1813
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1925..2017
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2027..2125
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2423..2647
                     /gene="Nfkb1"
                     /note="Death domain of the Nuclear Factor-KappaB1
                     precursor protein p105; Region: Death_NFkB1_p105; cd08797"
                     /db_xref="CDD:260063"
ORIGIN      
ttctcattccctttactagatatttcatttgaatcctttgtctcatactatatttaatccagaattatttccaccagagatgccactgcccacagatggcccataccttcaaatattagagcaacctaaacagagaggatttcgtttccgttacgtttgtgaagggccatcccatggcggacttcctggtgcatctagtgagaagaacaagaagtcctaccctcaggtcaaaatatgcaactatgtgggacctgcaaaggttattgttcagttggtcacaaacggaaaaaatatccacctgcacgctcacagcctggtgggaaaacactgtgaggatggaatctgcactgtgaatgctggacccaaggacatggtggtcggctttgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacggatgaccgacgcatgtgtaaggggctacaatccaggacttttagtgcaccctgaccttgcctatttgcaagcagaaggtggaggagaccggcagctcacagatcgggaaaaggagctcatccgccaggcagctcttcagcagacgaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttcctgacagcacgggcagcttcaccaggcgcctggaacccgtggtgtcagacgccatctatgacagcaaagcacccaatgcatccaacttgaaaatcgtaagaatggacaggacagctggatgtgtaactggaggggaagaaatttatcttctctgtgacaaagttcagaaagatgatatccagattcgtttttatgaagaggaggaaaatggtggagtctgggaaggatttggagatttttcccctacagatgttcatagacaatttgccattgtcttcaaaacgccaaagtataaagatgtcaacattacaaaaccagcctctgtgtttgtccagcttcggaggaaatctgatttggaaactagcgaaccaaaaccttttctctactatcctgaaatcaaagataaagaggaagtgcagaggaaacggcagaagctcatgcccaatttttcggatagtttcggcggcggtagcggtgccggggctggaggcggaggcatgttcggtagcggcggtggaggagggagcacgggaactacgggtccagggtatggcttcccgcactatggatttcctacgtacggtggaattaccttccaccctggaaccactaaatccaatgctggactgaagcatggaaccatgaatgctgaatctaaaagtgatcctgaagattgtgacacgaggggtggcagagagactataaatctctctgggaacgttatcaaaaccacagaacaagataaggaactgggcatgtccagcgacggaaatgaggaggtgacgccgacgtgcaccatgggagtaaaggaagaggatgctcggtttcaggataacctctttctggagaaggctatgcagcttgccaagaggcacgccaacgcccttttcgactatgcagtgacgggagacgtgaagatgctgctggctgtccagcggcatctcactgcagtgcaggatgagaatggggacagtgtcttacacttagccatcatccaccttcatgctcagcttgtgagggatctgctagaagttacatctggtttggtttctgatgatattatcaacatgagaaatgatctgtaccagacgcccttgcacttggcagtgatcactaagcaggaagatgtggtggaggacttgctgagcgctggggctgacctgagccttctggaccgcttgggtaactctgttttgcacctagctgccaaagaaggacatgataaagttctcagtattttactcaagcacaaaaaggcagcactacttcttgaccatcccaacggggaaggtctgaatgccattcacatagccgtgatgagcaatagcctgccatgtctgctgctgctggtggccgctggagcagacgtcaacgcacaggagcagaagtctgggcgaacggcactgcacctggctgtggagcatgacaatatctccttggcgggctgcctgctcctggagggggatgcccacgtggacagtaccacctatgatggaactacacccctacacatcgcagccggcagagggtccaccaagctggcagctcttctcaaagcagcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaaggctggagaggacgaaggggtcgtgcctggaaccacacccctagatatggctaccagctggcaggtatttgacatcttaaatgggaagccatatgagccagagtttacatctgaggatttgctggcacagggagacatgaaacagctgactgaagatgcaaaactgcagctctacaagttgctagaaatccctgatccagacaaaaactgggctactctggcacagaagttaggtctggggatacttaacaatgccttccggctgagccctgccccttccaaaactctcatggacaactatgaggtctctggggggacggtcaaagagctggtggaggccctgagacagatgggctacacggaagcaatcgaagttatccaggcggccttctgcacctcagaagcctccagccctgtgaagaccacctctcaggcccactcactgcctctcttgccttcctccacaaggcagcaaatagatgagctgcgagacaatgacagcatctgtgacagtggtgtggagacatccttccgcaaactcagctttacagagtctctgaccaacagcagctcattgctaactcttaacaaaatgccccaagattacgggcaggaaggacctatagaaggcaaaatttagcctgctggcagtttcccacgctgtgtaaaccaaagtcctagaatcccactgcgttgtccaaaagaaggaaagtaaagtgcatccagaggtgctcagaggaacagcggcctgcctgaatcatgctggatttaattcaaggctgtctaaacatgacttcctttcctggtttttcaatgagttttagttgattcacttgccaatagtatctagcaatcccagcactgcgctgaactgatgtgtcctggggatgaggtagtttattgagctttaccggctgctactggattacagttgctttttgttgtcattgctgctgtccctctgctgcattcccactgtcagggtgtcctcacctggtgttctttctagccgtccatggcacagttgtgcattcagattaaggattaagaaaagagatatttgaatatcagagtcacttagtgtgcaattaaaaaaaaaaggcttattgctttttttaatgtggttatctctgtgatttgaaaaacacatgaacttatcaatatttaaacatggttataatcagtgctgaaaatgatattttcccctttttctgcattttgctattgtaaatatgttttttagatcaaatactttaaaggaaaaatgttggatttataaatgctattttttattttacttttataataaaagga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]