2025-09-18 13:20:47, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XM_044587492 2580 bp mRNA linear PLN 18-APR-2025 DEFINITION PREDICTED: Triticum aestivum ubiquitin-like-specific protease 1D (LOC123169622), transcript variant X2, mRNA. ACCESSION XM_044587492 VERSION XM_044587492.1 DBLINK BioProject: PRJNA764258 KEYWORDS RefSeq. SOURCE Triticum aestivum (bread wheat) ORGANISM Triticum aestivum Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP clade; Pooideae; Triticodae; Triticeae; Triticinae; Triticum. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_057814.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_018294505.1-RS_2025_04 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 04/16/2025 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2580 /organism="Triticum aestivum" /mol_type="mRNA" /cultivar="Chinese Spring" /db_xref="taxon:4565" /chromosome="7D" /tissue_type="leaf" /dev_stage="Vegetative" /geo_loc_name="USA: Davis, California" gene 1..2580 /gene="LOC123169622" /note="ubiquitin-like-specific protease 1D; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 5 ESTs, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 57 samples with support for all annotated introns" /db_xref="GeneID:123169622" CDS 33..2291 /gene="LOC123169622" /codon_start=1 /product="ubiquitin-like-specific protease 1D isoform X2" /protein_id="XP_044443427.1" /db_xref="GeneID:123169622" /translation="
MPEAPAVSIVDFSSAASSFSSPTPTSPRPRPLGEPRRAAVNAMATASSEPLPSGEEGDEDAGARIDDDLRGMSDQALKERFKRLQDGLNKFPGVLPDGGKKYRRSLRAVRGELDRRTRLASDSASLRPRPRPPRPQGRLGEPDGNRGERMIQSSCAEPSGLSSKCNENHGVTKSDFLSAFEVDDEAGIDVEITSICPGKTKTPVENKGKSYAVSESCKTNAQPTPPKVLCIDNSIDVENMSSDDDFKDNGDIRTRENASTPSRKRKGDDSVNFSMRLRPRKAQEVVLLDADAHHSESAEKPTTKRDAMKIYYPSSEHSNSIELSHDDIKCLEPESLLSSTIMNFYIMYLQGPMSSISTQRGKYHIFNTYFFKKLEALKSKVDKPSYFLNLRRWWKGIDIFQKPYILFPVHADTHWSLVIICMPAKEDQSGPIILHLDSLKFHNSRLIFSVVERFLKQEWNYLKENGSLAECPIRETVWKKLPHKIEKKPIARFIEEAPERLHKKDLSMFGKTWFQPEEASALRKKMKTLLHQLFEEADPSNDSTSEQTACQLLLEAKPANNVMELATSEHPLEVSSAEVIPTSEHLLEVGSVEMTPMSEHPLEVGSAEMSPTQEHPLVCSSGEMAPAQEHPLVGSSAEMEPTQEHPLVGNSAEMEPKQEYPLVGSSAEMAPTQEHTLVGSSAEMAPTQEHPLVGSSAEMEPTQEHPTVGSSAEMEQTQGHPMVGSSAEITSQKPLEGTSTRPTSFEHPLECS"
misc_feature 1041..>1421 /gene="LOC123169622" /note="Ulp1 protease family, C-terminal catalytic domain; Region: Peptidase_C48; cl23802" /db_xref="CDD:420019" misc_feature <1635..2195 /gene="LOC123169622" /note="EBNA-3B; Provisional; Region: PHA03378" /db_xref="CDD:223065" polyA_site 2580 /gene="LOC123169622" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
cgtttctttttgcgagaaggccctcctccaatatgccagaggccccggctgtcagcatcgtcgacttctcctccgccgcctcctctttctcttccccaaccccaacttcccctcgaccccgccccctcggcgagccgcgccgcgccgcggtgaatgcgatggccacggcttcgtcggagccgctccccagcggcgaggagggggacgaggatgcgggggcgaggatcgatgacgaccttcgcggcatgtcggaccaggcgctgaaggagaggttcaaacgcctacaggacgggctcaacaaattccccggcgtcctcccggacggtgggaagaagtaccgccgctcgctccgggccgtccgcggcgagctcgaccgccgcactcgcttggcctcggactcggcctctctccggccacggccgcggccgccgcgtccgcaaggccgcctaggcgagccggatggcaatagaggtgaacggatgatccagtcaagttgtgcagaaccgtctgggttgtctagtaaatgcaatgaaaatcatggagtaaccaaatctgatttcctttctgcatttgaggtggatgatgaggcaggcatcgatgtggagataacaagtatatgccctggcaagactaaaacgccagtagaaaataaagggaagtcgtatgcagtaagtgaatcttgcaaaaccaatgcacaaccaacgcctcccaaagtattatgtatcgacaactcaatcgacgtggaaaatatgtcttctgacgatgacttcaaggataacggcgatattaggacacgtgaaaatgcttccacaccttctcggaaaaggaaaggagatgactcagtaaacttctcaatgcgattgagaccaagaaaggctcaagaggtggttctactcgatgcagatgcacaccattcagaatctgcagagaagccaaccactaaacgggatgcaatgaagatatattatccctcaagcgaacactcaaattctattgagctttctcatgatgacataaaatgccttgagcctgaatcgttactttcctcaactataatgaacttctacattatgtacctgcaagggccaatgtcatcgattagtacacaaagaggcaagtatcacattttcaatacatacttcttcaagaaacttgaagccctaaaatcaaaggtagacaagccttcttatttcttaaacctgagaagatggtggaaaggcatagatatatttcaaaagccatatatattatttcctgtgcatgcagatactcattggagcctggtgattatatgcatgccagcaaaggaagatcaatcaggccccattatacttcatttggattcactgaagttccataacagcagattgattttcagtgttgttgagagattcttaaaacaagaatggaattacctgaaggaaaatgggtctttagcagaatgtcctatacgagaaacggtgtggaagaaacttcctcataaaattgagaagaaaccaattgcgcggttcatcgaggaggcacctgaaaggcttcacaagaaagacctttctatgtttggcaaaacatggtttcaacctgaagaggcttctgcattgcgaaagaaaatgaagaccctgcttcatcagttgtttgaggaagcggatcccagtaacgatagtacatcggagcagacagcgtgtcagttgcttttggaagctaagcctgcaaacaacgtgatggagctggcaacgtcagaacaccctttggaagtcagttcagctgaggtgataccaacgtcggaacacctgctggaagtcggttctgttgagatgacaccaatgtctgaacaccctttggaggtcggttctgctgagatgtcaccaacgcaagaacatcctttggtgtgcagttctggtgagatggcaccagcgcaagaacatcctttggtgggcagttcggctgagatggaaccaacacaagaacatcctttggtgggcaattcggctgagatggaaccaaagcaagaatatcctttggttggcagttcggctgagatggcaccaacgcaagaacataccttggtgggcagttcggctgagatggcaccaacgcaagaacatcccttggtgggcagttcggccgagatggaaccaacgcaagaacatcctacggtgggcagttccgccgagatggaacaaacgcaaggacatcctatggtgggcagttccgccgagattacatcgcagaaacctttggaaggcacttcgacccgaccaactagttttgagcaccctttggaatgcagctgattgatgttaccacctttggagcgacctacgttacccgtagaaaccgaaaccggctcggaattgtattatagatgggaaggtgttgtagcctgcatctgtgggcaactttgagggaggggtggtgttgcatgactgaacgttgcagttaatgtatccgcgggaactaccgtgtatatataatatcagtaggagaaatggtgggtgtacgagtcgctcaggatggacttcatctgtttagttatttataggctaggctggaagaggtcaataaaatctcaggctctgatta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]