2025-04-04 22:14:59, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XM_044018916 732 bp mRNA linear VRT 03-OCT-2021 DEFINITION PREDICTED: Solea senegalensis NADH-ubiquinone oxidoreductase chain 5-like (LOC122764914), mRNA. ACCESSION XM_044018916 VERSION XM_044018916.1 DBLINK BioProject: PRJNA767562 KEYWORDS RefSeq; includes ab initio. SOURCE Solea senegalensis (Senegalese sole) ORGANISM Solea senegalensis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Carangaria; Pleuronectiformes; Pleuronectoidei; Soleidae; Solea. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_025322517.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Solea senegalensis Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 55% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..732 /organism="Solea senegalensis" /mol_type="mRNA" /isolate="Sse05_10M" /db_xref="taxon:28829" /chromosome="Unknown" /sex="male" /tissue_type="blood" /dev_stage="Breeder" gene 1..732 /gene="LOC122764914" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 44% coverage of the annotated genomic feature by RNAseq alignments, including 8 samples with support for all annotated introns" /db_xref="GeneID:122764914" CDS 1..732 /gene="LOC122764914" /codon_start=1 /product="NADH-ubiquinone oxidoreductase chain 5-like" /protein_id="XP_043874851.1" /db_xref="GeneID:122764914" /translation="
MVITFFMFFMVIMVLMFFMFFMFFMVFMILTVFMVIMFFKVFMVIMVIMFFMILMVFMVIMFFMILMVFMVIMVIMVFMVIMVIMFFMFFMVIMVFMVIMFFMILMVFMVIMFFMVFMVIMVFMFFMVFMVIMFLMVFMFFMILMVFMVIMVFMILMVFMVIMFFMVIMVFMFFMVFMVIMFLMVFMFFMVFMFFMFFMVFMVIMFFMVIMFFMVIMFFMVFMVIMVIMVFMVFILLLMNNLC"
ORIGIN
atggtcatcacattcttcatgttcttcatggtcatcatggtcctcatgttcttcatgttcttcatgttcttcatggtcttcatgatcctcacggtattcatggttatcatgttcttcaaggtattcatggtcatcatggtcatcatgttcttcatgatcctcatggtcttcatggtcatcatgttcttcatgatcctcatggtcttcatggttatcatggttatcatggtcttcatggtcatcatggtcatcatgttcttcatgttcttcatggtcatcatggtcttcatggtcatcatgttcttcatgatcctcatggtcttcatggttatcatgttcttcatggtattcatggtcatcatggtctttatgttcttcatggtcttcatggtcatcatgttcttgatggtcttcatgttcttcatgatcctcatggtcttcatggttatcatggtcttcatgatcctcatggtcttcatggttatcatgttcttcatggtcatcatggtctttatgttcttcatggtcttcatggtcatcatgttcttgatggtcttcatgttcttcatggtcttcatgttcttcatgttcttcatggtattcatggtcatcatgttcttcatggtcatcatgttcttcatggtcatcatgttcttcatggtcttcatggtcatcatggtcatcatggtcttcatggtcttcatcctcctgctgatgaataatctctgctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]