LOCUS       XM_039848854            3384 bp    mRNA    linear   MAM 02-MAR-2021
DEFINITION  PREDICTED: Pteropus giganteus nuclear factor kappa B subunit 1
            (NFKB1), transcript variant X1, mRNA.
ACCESSION   XM_039848854
VERSION     XM_039848854.1
DBLINK      BioProject: PRJNA703023
KEYWORDS    RefSeq.
SOURCE      Pteropus vampyrus (large flying fox)
  ORGANISM  Pteropus vampyrus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Chiroptera; Yinpterochiroptera;
            Pteropodoidea; Pteropodidae; Pteropodinae; Pteropus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024352786.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Pteropus giganteus Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3384
                     /organism="Pteropus vampyrus"
                     /mol_type="mRNA"
                     /isolation_source="ENVO:00010625"
                     /db_xref="taxon:132908"
                     /chromosome="Unknown"
     gene            1..3384
                     /gene="NFKB1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 mRNAs, 12 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 103 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:120591230"
     CDS             136..3051
                     /gene="NFKB1"
                     /codon_start=1
                     /product="nuclear factor NF-kappa-B p105 subunit isoform
                     X1"
                     /protein_id="XP_039704788.1"
                     /db_xref="GeneID:120591230"
                     /translation="

MAEDDPYLGGHEQMFHLDPLNHTIFNPELFQPQMPLQTADGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNIHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLAYLQAEGGGDRQLTDREKEIIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGIWEGFGDFSPTDVHRQFAIVFKTPKYKDINITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGGGAGAGGGGMYGSGGGGGGAGSTGPGYGFPHYGFPTYGGITFHPGTTKSNAGMKHGTIDTSSKNDPEYCDKSDDRKAVNLSGKVTETTEQDKESGNWGDEAALTYTVGVKEENARFQDNLFLEKAVQLAKRHANALFDYAVTGDVKMLLAVQRHLTTVQDENGDSVLHLAIIHLHAQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQEAVVEDLLRAGADLSLLDRLGNSVLHLAAKEGHDKILGILLKHKRTALLIDHPNGEGLNAIHIAVMSNSMQCLLLLVAAGADVNAQERKAGHTALHLAVERDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWEKDGEDEGVIPGTTPLDMATNWQVFDILNGKPYEPEFTSDDLLAQGDMKQLTEDAKLQLYKLLEFPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTIRELVEALRQMGYTEAIEVIQAAFSTSGTAAPSPVKTSQVHLLPLSPASTRQQIDELQDDSICDSGVETSFRKLSFTESLTSSSSLLTLNKMPHDYGQDGPIEGKI"

     misc_feature    259..864
                     /gene="NFKB1"
                     /note="N-terminal sub-domain of the Rel homology domain
                     (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region:
                     RHD-n_NFkB1; cd07935"
                     /db_xref="CDD:143651"
     misc_feature    order(301..303,307..312,316..321,328..339,562..564,
                     568..573,862..864)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143651"
     misc_feature    883..1188
                     /gene="NFKB1"
                     /note="IPT domain of the transcription factor NFkappaB and
                     related transcription factors. NFkappaB is considered a
                     central regulator of stress responses, activated by
                     different stressful conditions, including physical stress,
                     oxidative stress, and exposure to...; Region:
                     IPT_NFkappaB; cd01177"
                     /db_xref="CDD:238582"
     misc_feature    order(886..888,892..900,904..912,1030..1038,1075..1077,
                     1111..1113,1168..1170,1177..1179,1183..1185)
                     /gene="NFKB1"
                     /note="ankyrin protein binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238582"
     misc_feature    order(892..897,901..903,940..942,946..948,952..954,
                     1051..1056,1063..1065,1069..1071)
                     /gene="NFKB1"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238582"
     misc_feature    order(955..957,961..963,1054..1059)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238582"
     misc_feature    1612..2436
                     /gene="NFKB1"
                     /note="Ankyrin repeat [Signal transduction mechanisms];
                     Region: ANKYR; COG0666"
                     /db_xref="CDD:440430"
     misc_feature    order(1750..1752,1756..1758,1768..1773,1780..1788,
                     1792..1797,1807..1809,1816..1818,1861..1863,1867..1869,
                     1873..1875,1885..1890,1897..1905,1909..1914,1924..1926,
                     1933..1935,1960..1962,1966..1968,1972..1974,1984..1989,
                     1996..2004,2008..2013,2023..2025,2032..2034)
                     /gene="NFKB1"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    1750..1863
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1867..1962
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2074..2166
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2176..2274
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2572..2796
                     /gene="NFKB1"
                     /note="Death domain of the Nuclear Factor-KappaB1
                     precursor protein p105; Region: Death_NFkB1_p105; cd08797"
                     /db_xref="CDD:260063"
ORIGIN      

gatcagacccgcgcccggacctgccccgaccgggccggccgccgccgcctccttccccggcccccaggcccgcgccgccccgcagagggagccgcggcgcacggacaccgaacgcggtcgccgccaggctccagaatggcagaagacgatccgtatttgggaggccatgaacaaatgtttcatttggatcctttgaatcatacaatatttaatccagaattatttcaaccacagatgccactgcagacggcagatggcccatatcttcaaatattagagcaacctaaacagagaggatttcgtttccgctatgtctgtgaaggcccatctcatggtggactccctggtgcatctagtgagaagaacaagaagtcctaccctcaagtcaaaatctgcaactatgtgggacctgcaaaggttattgttcagttggtcacaaatggaaaaaacatccacctgcatgcacacagcctggtggggaaacattgtgaggatgggatctgcactgtgactgctggacccaaggacatggtggtcggctttgcaaacctgggtatacttcatgtgacaaagaaaaaagtattcgaaacactggaagcacgaatgacagaggcatgtattaggggctacaatcctggacttctggtacatcctgatcttgcctacttgcaagcagaaggtggaggagaccggcagctcactgatcgggaaaaggagattatccgccaggcagctcttcagcagacaaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttccagacagcaccggcagcttcacaaggcgcctggaacccgtagtgtcagatgccatctacgacagcaaagcccccaacgcgtccaacttgaaaattgtaagaatggacaggacagctggatgcgtaactggaggagaagagatttatcttctctgtgacaaggttcagaaagatgacatccagattcgattttatgaagaggaagaaaatggtggaatctgggaaggatttggagatttttcccccacagacgttcatagacaatttgccatcgtcttcaaaactccaaagtataaagatatcaacattacaaaaccagcctccgtgttcgtccaactacggaggaaatctgatttggaaaccagtgaaccaaaaccttttctctactaccctgaaatcaaagataaagaggaagtgcagaggaagcggcagaagctcatgcccaatttctcagatagttttggcggcggcggtggtgccggggctggaggcggaggcatgtatggcagtggcggtggaggagggggtgctggaagcacgggtccaggatatggcttccctcactatggctttcctacatatggaggaattaccttccatcctggaaccactaaatctaatgctggaatgaagcatggaaccatagacacctcatctaaaaatgaccctgaatactgtgacaagagtgatgacagaaaggctgtaaatctctctgggaaagtaaccgaaaccacagagcaagataaggagtccggcaattggggtgatgaggctgctctgacgtatacagtgggagtaaaggaagagaacgctaggtttcaggataacctctttctagagaaggctgtgcagcttgccaagcggcatgccaatgccctatttgactacgcagtgacaggagatgtgaagatgctgctggctgtccagcgccatctcactacagtgcaggatgagaatggagacagtgtcttacacttagcaatcatccaccttcatgctcaacttgtgagggatctgctagaagtcacatctggtttgatttccgatgacattatcaacatgagaaatgacctctaccagacgccgttgcacttagcagtaatcaccaaacaggaagctgtggtggaagacttactgagggccggggctgacctgagccttctggaccgcttgggtaactctgttctgcacctagctgccaaagaaggacatgataaaattctcggtattttactcaagcataaaaggacagcactacttatcgaccatcccaatggggaaggtctgaacgccattcatatagccgtgatgagcaacagcatgcagtgtctgctgctgctggtggccgcaggggcagacgtcaacgcccaggagcggaaggcagggcacacggcgctgcacctggctgtggagcgcgacaacatctccttggccggctgcctgcttctggagggtgatgcccatgtagacagtaccacctatgatggaactacaccccttcacatagcggccggaagagggtccaccaggctggcagctcttctcaaagcagcaggagcagatcccctggtagagaactttgagcctctctatgacctggacgactcttgggaaaaagatggagaggatgaaggagtcattcctggaaccacacctctagatatggccaccaactggcaggtattcgacatattaaatgggaaaccatatgagccagagtttacatctgatgatttactggcacaaggagacatgaaacagctgaccgaagatgccaagttgcagctctacaagttgctagaatttcctgatccagacaaaaactgggctactcttgcacagaaattaggtctgggaatactcaataatgccttccggctgagtcccgctccctctaaaactctcatggacaactacgaggtctctgggggcacaataagagagctggtagaggccctcagacagatgggctatactgaagccattgaagtgatccaggcggccttcagcacctcaggaactgcagcccccagcccagtgaagacctcccaggtccacctgctgcctctctcacctgcctccacaagacagcaaatagatgagctccaggacgacagcatctgtgacagcggcgtggagacatccttccgcaaactcagctttacagagtctctgaccagcagcagctcattgctaactcttaacaaaatgccccacgattatgggcaggatggacctatagaaggcaaaatctagccttctggcaattcccaacctgtaaaccaaagttctgaaattccgtggtattgtccaaaagagggtaaagtgcatccatccagtggtgcttggaggaaaacctgccagcctgaatcgctcttgatttaactcaaagcctttgaaacgtggtttcctttcttgattcttaaatgaatttcagttcggctcacttgcagatagtatctagccgtcacagccttcggcaaggctggtgcttcgttgggggtgagataacttgttgagctttactagctgctttctgttgtcattgctgccatccctctgctgctgtcattaaagagtctcacggtc

//