2025-08-18 16:39:17, GGRNA.v2 : RefSeq release 230 (May, 2025)
LOCUS XM_037731406 3659 bp mRNA linear PRI 20-NOV-2020 DEFINITION PREDICTED: Cebus imitator nuclear factor kappa B subunit 1 (NFKB1), transcript variant X3, mRNA. ACCESSION XM_037731406 VERSION XM_037731406.1 DBLINK BioProject: PRJNA328123 KEYWORDS RefSeq. SOURCE Cebus imitator (Panamanian white-faced capuchin) ORGANISM Cebus imitator Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Platyrrhini; Cebidae; Cebinae; Cebus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_016107712.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Cebus imitator Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3659 /organism="Cebus imitator" /mol_type="mRNA" /isolate="Cc_AM_T3" /db_xref="taxon:2715852" /chromosome="Unknown" /sex="male" /dev_stage="adult" /geo_loc_name="Costa Rica" gene 1..3659 /gene="NFKB1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 mRNA, 238 ESTs, 1 Protein, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 15 samples with support for all annotated introns" /db_xref="GeneID:108289254" CDS 397..3159 /gene="NFKB1" /codon_start=1 /product="nuclear factor NF-kappa-B p105 subunit isoform X3" /protein_id="XP_037587334.1" /db_xref="GeneID:108289254" /translation="
MAEDDPYLGRPEQMFHLDPLTHTIFNPEVFQPQMALPTADGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNTHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLAYLQAEGGGDRQLGDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKGYSFPHYGFPTYGGITFHPGTTKSNAGMKHGTMDSESKKDPEGCDKSDDRDTVNLFGKVTETTEQDQEPSKATDGNGEVALTYATETKEESAGVQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHSQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQENVVEDLLRAGADLSLLDRFGNSVLHLAAKEGNDKVLSILLKHKKAALLLDHPNGDGLNAIHLAMMSNSLPCLLLLVAAGANVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWENAGEDEGVVPGTTPLDMATSWQVFDILNGKPYEPEFTSDDLLAQGDMKQLAEDVKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVRELVEALRQMGYTEAVEVIQAASSPVKTTSQAHSLPLSPASTRQQIDELRDSDSVCDSGVETSFHRLSFTESLTSGGSLLTLNKMPHDYGQEGPLEGKI"
misc_feature 520..1125 /gene="NFKB1" /note="N-terminal sub-domain of the Rel homology domain (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region: RHD-n_NFkB1; cd07935" /db_xref="CDD:143651" misc_feature order(562..564,568..573,577..582,589..600,823..825, 829..834,1123..1125) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143651" misc_feature 1144..1449 /gene="NFKB1" /note="IPT domain of the transcription factor NFkappaB and related transcription factors. NFkappaB is considered a central regulator of stress responses, activated by different stressful conditions, including physical stress, oxidative stress, and exposure to...; Region: IPT_NFkappaB; cd01177" /db_xref="CDD:238582" misc_feature order(1147..1149,1153..1161,1165..1173,1291..1299, 1336..1338,1372..1374,1429..1431,1438..1440,1444..1446) /gene="NFKB1" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(1153..1158,1162..1164,1201..1203,1207..1209, 1213..1215,1312..1317,1324..1326,1330..1332) /gene="NFKB1" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(1216..1218,1222..1224,1315..1320) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" misc_feature 1744..2526 /gene="NFKB1" /note="Ankyrin repeat [Signal transduction mechanisms]; Region: ANKYR; COG0666" /db_xref="CDD:440430" misc_feature order(1876..1878,1882..1884,1894..1899,1906..1914, 1918..1923,1933..1935,1942..1944,1987..1989,1993..1995, 1999..2001,2011..2016,2023..2031,2035..2040,2050..2052, 2059..2061,2086..2088,2092..2094,2098..2100,2110..2115, 2122..2130,2134..2139,2149..2151,2158..2160) /gene="NFKB1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 1876..1989 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1993..2088 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature order(2200..2202,2206..2208,2218..2223,2230..2238, 2242..2247,2257..2259,2266..2268,2293..2295,2302..2304, 2308..2310,2320..2325,2332..2340,2344..2349,2362..2364, 2371..2373,2398..2400,2404..2406,2410..2412,2422..2427, 2434..2442,2446..2448) /gene="NFKB1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 2200..2295 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2302..2400 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2695..2922 /gene="NFKB1" /note="Death domain of the Nuclear Factor-KappaB1 precursor protein p105; Region: Death_NFkB1_p105; cd08797" /db_xref="CDD:260063" ORIGIN
ccaccggagcggcccggcgacgcgctgacagcttcccctgcccttcccgtcggtcgggccgccagccgccgccgccctcggcctgcacgccgccgccagccccgctcccggagcccagcgccgccgaggccgcagccgcccggccaggaaggcggcgccgccgcccggccacagcgcgccctgcgcttccctccgcccgcgctgcggacatggcgcggcgctgactggcccagcctggccccgctgcgctctctctcgccccgacccacacccgggcccgctcgggctccggccggccgccgcctcttccttctccagcttttaggcccgcgccgcccgggagggagagcccacccgcgacagaggccgaacgctgactcgccacccggcttcagaatggcagaagatgatccatatttgggaaggcctgaacaaatgtttcatttggatcctttgactcatacaatatttaatccagaagtatttcaaccacagatggcactgccaacagcagatggcccataccttcaaatattagagcaacctaaacagagaggatttcgtttccgttacgtatgtgaaggcccatcccatggtggactacctggtgcctctagcgaaaagaacaagaagtcttaccctcaggtcaaaatctgcaactatgtgggaccagcaaaggttattgttcagttggtcacaaatggaaaaaatacccacctgcatgcccacagcctggtgggaaaacactgtgaggatgggatctgcactgtaactgctggacccaaggacatggtggtcggctttgcaaacttgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcgcgaatgacagaggcgtgtataaggggctacaatcccggactcttggtgcaccctgaccttgcgtatttgcaagcagaaggtggaggggaccggcagctgggagatcgggaaaaagagctaatccgccaggcagctctgcagcagaccaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttccggatagcactggcagcttcacaaggcgcctggaacccgtggtatcagacgccatctatgacagtaaagcccccaatgcatccaacttgaaaattgtaagaatggacaggacagctggatgtgtgactggaggagaggaaatttatcttctctgtgacaaagttcagaaagatgacatccagattcgattttacgaagaagaggaaaatggtggagtctgggaaggatttggagatttttcccctacagatgttcatagacaatttgccatcgtcttcaaaaccccaaagtataaagatgttaatattacaaaaccagcttctgtgtttgtccagcttcggaggaaatctgacttggaaactagtgaaccaaaacctttcctttactatcctgaaataaaagggtatagcttcccacactatggatttcctacttatggagggattaccttccatcctggaactactaaatctaatgctgggatgaaacatggaactatggacagtgaatctaaaaaggaccctgaaggttgtgacaaaagtgatgacagagacactgtaaacctctttggaaaagtcactgaaaccacagagcaggatcaggagcccagcaaggccaccgatgggaatggtgaggtcgctctaacgtatgcaacagaaaccaaagaagagagtgctggggttcaggataacctctttctagagaaggctatgcagcttgcaaagaggcatgccaatgcccttttcgactatgcagtgacaggagacgtgaagatgttgctggctgtccagcgccatctcactgctgtgcaggatgagaatggggacagtgtcttacacctagcaatcatccaccttcattctcaacttgtgagggatctactagaagtcacatctggtttgatttctgatgacattatcaacatgagaaatgacctgtaccagacacccttgcacttggcagtgatcactaagcaggaaaatgtggtggaggatttgctgagggccggggctgacctgagccttctggaccgcttcggtaactctgttttgcacctagctgccaaagaaggaaatgataaagttctcagtatcttactcaagcacaaaaaggcagcactacttcttgaccaccccaacggggacggtctgaatgccattcatctagccatgatgagcaatagcctgccatgtctgctgctgctggtggccgctggggccaacgtcaatgctcaggagcaaaagtctggacgcacagccctgcacctggctgtggagcacgacaacatctcattggcaggctgcctgctcctggagggtgatgcccatgtggacagtactacctacgatggaactacacccctgcatatagcagctgggagagggtccaccaggctggccgctcttctcaaagcagcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaatgcaggagaggatgaaggagttgtacctggaaccacacctctagatatggccaccagctggcaggtatttgacatattaaatgggaaaccatatgagccagagtttacatctgatgatttactggcacaaggagacatgaaacagctggctgaagatgtgaagctgcagctctataagttgctagaaattcctgatccagacaaaaactgggctactttggcacagaaattaggtctggggatacttaataatgccttccggctgagtcctgctccttccaaaacacttatggacaactatgaggtctctggggggacggtcagagagctggtggaggccctgagacaaatgggctacaccgaagcagttgaagtgatccaggcagcctccagcccagtgaagaccacctcgcaggcccactcactgcctctctcacctgcatccacaaggcagcaaatagatgagctccgagacagcgacagtgtctgcgacagcggcgtggagacgtccttccacaggctcagcttcaccgagtctctgaccagtggtggctcactgctaactctcaacaaaatgccccatgattatgggcaggaaggacctctagaaggcaaaatttagcctgctgacaatttcccacaccatgtaaaccaaagccctgaaattccactgcattgtccacaagaagaaagctgaagcgcatccaaaggtgctcagagagctggcctgccagaatcattctcgatttaacgcaaggccttttcaacttggcttcctttcttggttcataaatgaattttagtttggttcacttacagatagtatctagcaatcatagcactggctgagcggatgcatctggggatgaggctgcttactgagctttgccggccgctgctggatcacagctgctttctgttgtcattgttgtccctctgctacgttcctgttgtcattaaagtgtcactggccccacctggcattccttctgaccacccacagcatcgttttgcattcaaattaagcgttaagaaaagggatattttaaaatgaaagtcacttgatgtgcaatttaaaaaaaaggcgtattactttttctaatgtggttatttctcggcttt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]