GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-08-18 16:35:48, GGRNA.v2 : RefSeq release 230 (May, 2025)

LOCUS       XM_036253237            3622 bp    mRNA    linear   MAM 29-SEP-2020
DEFINITION  PREDICTED: Molossus molossus nuclear factor kappa B subunit 1
            (NFKB1), transcript variant X1, mRNA.
ACCESSION   XM_036253237
VERSION     XM_036253237.1
DBLINK      BioProject: PRJNA665629
KEYWORDS    RefSeq.
SOURCE      Molossus molossus (Pallas's mastiff bat)
  ORGANISM  Molossus molossus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Chiroptera; Yangochiroptera;
            Molossidae; Molossus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_023425344.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Molossus molossus Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3622
                     /organism="Molossus molossus"
                     /mol_type="mRNA"
                     /isolate="mMolMol1"
                     /db_xref="taxon:27622"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /geo_loc_name="Panama: Gamboa"
                     /lat_lon="9.1165 N 79.6965 W"
                     /collection_date="2018"
                     /collected_by="Dina Dechmann"
     gene            1..3622
                     /gene="NFKB1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 14 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 4 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:118624789"
     CDS             56..2968
                     /gene="NFKB1"
                     /codon_start=1
                     /product="nuclear factor NF-kappa-B p105 subunit isoform
                     X1"
                     /protein_id="XP_036109130.1"
                     /db_xref="GeneID:118624789"
                     /translation="
MAEEDPYLGGHEQMFHLDPLNHTIFNSEIFQSEMPLPTADGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQIKICNYSGPAKVIVQLVTNGKSIHLHAHSLVGKHCEDGICTVMAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLAYLQAEGGGDRQLTDREKEIIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGIWEGFGDFSPTDVHRQFAIVFKTPKYKDINITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGGAGAGGGGMYGSGGGGGGTGSAGPGYGFPHYGFPYGGITFHHGATKSNAGMKHGAMDTSSKNDPGGCEESDDREAVSLSGEGTKTPEQHKGSSSRDDEATLAYPVGVKEENSGFLDSLFLEKAMQLARRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDCVLHLAIIHLHAQLVRDLLEVTSGLVLDDIINMRNDLYQTPLYLAVITKQEAVVEDLLRAGVDLSLLDHLGNSVLHLAAKEGHDRILGTLLKHKKAALLIDHPNGEGLNAIHIAVMSNSMPCLLLLVAAGADVNAQEQKSGRTALHLAVEQDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRMAALLKAAGADPLLENFEPLYDLDDSWEKDGDDEGVVPGTTPLDMATNWQVFDILNGKPYEPEFTSDDLLAQGDMKQLTEDTKLQLYKLLEFPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTIRELMEALRQMGYTEAIEVLQAAFCASGTAGPSPLETAPQAHSRPLSPASTRQQLDELRDDSICDSGVETSFRKLSFTESLTSGSSLLTLNKMPHDYGQEGPIEGKI"
     misc_feature    179..784
                     /gene="NFKB1"
                     /note="N-terminal sub-domain of the Rel homology domain
                     (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region:
                     RHD-n_NFkB1; cd07935"
                     /db_xref="CDD:143651"
     misc_feature    order(221..223,227..232,236..241,248..259,482..484,
                     488..493,782..784)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143651"
     misc_feature    803..1108
                     /gene="NFKB1"
                     /note="IPT domain of the transcription factor NFkappaB and
                     related transcription factors. NFkappaB is considered a
                     central regulator of stress responses, activated by
                     different stressful conditions, including physical stress,
                     oxidative stress, and exposure to...; Region:
                     IPT_NFkappaB; cd01177"
                     /db_xref="CDD:238582"
     misc_feature    order(806..808,812..820,824..832,950..958,995..997,
                     1031..1033,1088..1090,1097..1099,1103..1105)
                     /gene="NFKB1"
                     /note="ankyrin protein binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238582"
     misc_feature    order(812..817,821..823,860..862,866..868,872..874,
                     971..976,983..985,989..991)
                     /gene="NFKB1"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238582"
     misc_feature    order(875..877,881..883,974..979)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238582"
     misc_feature    1526..2314
                     /gene="NFKB1"
                     /note="Ankyrin repeat [Signal transduction mechanisms];
                     Region: ANKYR; COG0666"
                     /db_xref="CDD:440430"
     misc_feature    1679..1777
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1787..1876
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1880..1984
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    order(1988..1990,1994..1996,2006..2011,2018..2026,
                     2030..2035,2045..2047,2054..2056,2081..2083,2090..2092,
                     2096..2098,2108..2113,2120..2128,2132..2137,2150..2152,
                     2159..2161,2186..2188,2192..2194,2198..2200,2210..2215,
                     2222..2230,2234..2239,2249..2251,2258..2260,2285..2287)
                     /gene="NFKB1"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    1988..2083
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2090..2188
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2192..2287
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2486..2710
                     /gene="NFKB1"
                     /note="Death domain of the Nuclear Factor-KappaB1
                     precursor protein p105; Region: Death_NFkB1_p105; cd08797"
                     /db_xref="CDD:260063"
ORIGIN      
cggggagcccgcaggcgccgggaggccgcgcgccgacgcgccaccaggctccaaaatggcagaagaggatccatatttgggagggcatgaacaaatgtttcatttggatcctttgaatcatacaatatttaattcagaaatatttcagtcagagatgccactgccaacggcagatggcccataccttcaaatattagagcaacccaaacagagaggatttcgtttccgttatgtctgtgaaggcccgtcccatggcggactccccggtgcatctagtgagaagaataagaagtcctaccctcagatcaaaatctgcaactactcgggacctgccaaggttattgttcagttggtcacaaatggaaaaagcatccacctgcacgcacacagcctggtggggaagcactgtgaggacgggatctgcaccgtaatggctggacccaaggacatggtggtcggctttgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacgaatgacagaggcatgtataaggggctataatcccggacttttggtgcatcctgatcttgcctatttgcaagcagaaggtggaggagaccggcagctcacagatcgggaaaaggagatcatccgccaggcagctcttcagcagacaaaggagatggacctcagcgtggtgcggctcatgtttacagctttcctcccagacagcaccgggagcttcaccaggcgcctggaacccgtggtatcagacgccatctacgacagcaaagcccccaacgcgtccaacttgaaaattgtacgaatggacaggacagctggatgcgtcactggaggggaagaaatttatcttctctgtgacaaggttcagaaagatgacatccagattcgattttatgaagaggaggaaaatggtggaatctgggaaggatttggagatttttcccctacagacgttcacagacaatttgccatcgtcttcaaaacaccaaagtataaagacatcaacattaccaaaccagcctctgtgtttgtccaactacggaggaaatctgatttggaaactagtgaaccaaaaccttttctctactaccctgaaatcaaagacaaagaggaagtgcagaggaagcggcagaagctcatgcccaatttctcggacagctttggcggcggtggtgccggggctggaggcggaggcatgtacggcagcggcggtggaggagggggcacaggaagcgccgggccagggtatggcttcccccactatggatttccatatggtggaatcaccttccaccatggagccactaaatctaatgctgggatgaagcatggagccatggacacatcatctaaaaatgaccctggaggttgtgaggagagtgatgacagagaggctgtaagtctctctggggaaggaaccaaaaccccagagcaacataaggggtccagcagcagagatgatgaggctactctggcctatccagtgggagtgaaggaagagaattctgggtttctggacagcctcttcctggagaaggcaatgcagcttgccaggcggcacgccaacgccctgtttgactatgcggtgacaggagatgtgaagatgctgctggctgtccagcgtcacctcactgccgtgcaggatgagaacggggactgtgtcttacacttagcaatcatccacctccatgctcaacttgtgagggatctgctagaagtcacttctggtttggttttagatgacattatcaacatgagaaatgatctgtaccagacgcccttgtacttggcagtgatcaccaagcaggaggctgtggtggaggacttgctcagggctggggtcgatctgagccttctggaccacttgggtaactctgttttacacctagctgccaaagaaggacatgatagaattctcggtactttactcaagcacaaaaaggcagcactacttatcgaccaccccaatggggaaggtctgaacgccatccacatcgcggtgatgagcaacagcatgccctgtctgctgctgctggtggccgccggggcggacgtcaacgcgcaggagcagaagtcgggtcgcacggcgctgcacctggctgtggagcaggacaacatctccctggctggctgtctgctcctggagggtgatgcccacgtagacagtaccacctacgacggaactacaccgctgcacatagcggccgggagaggctccacccggatggcagcccttctgaaagcagcaggagcagatcctctgctggagaactttgagcctctctatgacctggacgattcctgggaaaaggatggagatgatgaaggagttgtgcctggaaccacacctctagatatggccaccaactggcaggtattcgacatattaaatgggaagccgtatgagccagagtttacatctgatgatttattggcacaaggagacatgaaacagctgactgaagacacaaagttgcagctttacaagttgctagaatttcccgatccagacaaaaactgggcaactctggcacagaaattaggtctggggatactcaataatgccttccggctgagtcctgctccttctaaaacgctcatggacaattacgaggtctctggagggaccataagagagctgatggaagccctgaggcagatgggctacaccgaagcgatcgaggtgctccaggccgccttctgcgcctcaggaactgcaggccccagcccactggagaccgccccgcaggcccactcgcggcctctctcacccgcctccaccagacagcaactagacgagctccgagacgacagcatctgtgacagcggcgtggagacatccttccgcaaactcagcttcacggagtctctgaccagcggcagctcattgctaactcttaacaaaatgccccacgattacgggcaggaaggacctatagaaggtaaaatttagccttctggcagttcccagcatcctgtaaaccaaagttctgaaattccactggactgtccaagagaaggaagggaaagtgcatccaggggtgctcagaggaacaccggccgccctggacagcgctgggcttcactcgaggcctctgagacccggctgccttcctcggctctccagggaatttcagcccggctcactggcatatagtctctagcaggcacggccttcggcggggctggtgcctcgtggaggtgaggtaccttgttgagctttaccggctgcttcctgtcatcattgctgctccccctctgctgtgtccccactgccattacaaggttaagtccccacctggtgtctttctcgccggccacagcacagtcgtgcactcagattaagaattaaggaaattcttaatattttatcaagaatattttaaataagatattttaaaaggcgccatcagtgtataattgaaagaggcttactgctttttctcacgtggtgtatctctgtgatttgaaaaaagaacatgtatgtgtcgatatttaaacatggttacaatcagtgctgaaaatggtcttttcccctttttctgcattttgctattgtaaatatgtttttagatcaaatactttaaaagaaagaatgttggattta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]