2025-04-05 08:58:51, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XM_032261612 3418 bp mRNA linear PRI 02-FEB-2020 DEFINITION PREDICTED: Sapajus apella nuclear factor kappa B subunit 1 (NFKB1), transcript variant X3, mRNA. ACCESSION XM_032261612 VERSION XM_032261612.1 DBLINK BioProject: PRJNA599380 KEYWORDS RefSeq. SOURCE Sapajus apella (tufted capuchin) ORGANISM Sapajus apella Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Platyrrhini; Cebidae; Cebinae; Sapajus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_022437064.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Sapajus apella Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.3 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3418 /organism="Sapajus apella" /mol_type="mRNA" /isolate="SASKATOON/1434" /db_xref="taxon:9515" /chromosome="Unknown" /sex="female" /tissue_type="blood" /dev_stage="adult" gene 1..3418 /gene="NFKB1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 269 ESTs, 1 Protein, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 22 samples with support for all annotated introns" /db_xref="GeneID:116538998" CDS 146..2908 /gene="NFKB1" /codon_start=1 /product="nuclear factor NF-kappa-B p105 subunit isoform X3" /protein_id="XP_032117503.1" /db_xref="GeneID:116538998" /translation="
MAEDDPYLGRPEQMFHLDPLTHTIFNPEVFQPQMALPTADGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNTHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLVYLQAEGGGDRQLGDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKGYSFPHYGFPTYGGITFHPGTTKSNAGMKHGTMDSESKKDPEGCDKSDDRVTVNLFGKVTETTEQDQEPSKAIDGNGEVALTYATETKEESAGVQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHSQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQEDVVEDLLRAGADLSLLDRFGNSVLHLAAKEGNDKVLSILLKHKKAALLLDHPNGDGLNAIHLAMMSNSLPCLLLLVAAGANVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWENAGEDEGVVPGTTPLDMATSWQVFDILNGKPYEPEFTSDDLLAQGDMKQLTEDVKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVRELVEALRQMGYTEAVEVIQAASSPVKTTSQAHSLPLSPASTRQQIDELRDSDSVCDSGVETSFHRLSFTESLTSGGSLLTLNKMPHDYGQERPLEGKI"
misc_feature 269..874 /gene="NFKB1" /note="N-terminal sub-domain of the Rel homology domain (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region: RHD-n_NFkB1; cd07935" /db_xref="CDD:143651" misc_feature order(311..313,317..322,326..331,338..349,572..574, 578..583,872..874) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143651" misc_feature 893..1198 /gene="NFKB1" /note="IPT domain of the transcription factor NFkappaB and related transcription factors. NFkappaB is considered a central regulator of stress responses, activated by different stressful conditions, including physical stress, oxidative stress, and exposure to...; Region: IPT_NFkappaB; cd01177" /db_xref="CDD:238582" misc_feature order(896..898,902..910,914..922,1040..1048,1085..1087, 1121..1123,1178..1180,1187..1189,1193..1195) /gene="NFKB1" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(902..907,911..913,950..952,956..958,962..964, 1061..1066,1073..1075,1079..1081) /gene="NFKB1" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(965..967,971..973,1064..1069) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" misc_feature 1493..2275 /gene="NFKB1" /note="Ankyrin repeat [Signal transduction mechanisms]; Region: ANKYR; COG0666" /db_xref="CDD:440430" misc_feature order(1625..1627,1631..1633,1643..1648,1655..1663, 1667..1672,1682..1684,1691..1693,1736..1738,1742..1744, 1748..1750,1760..1765,1772..1780,1784..1789,1799..1801, 1808..1810,1835..1837,1841..1843,1847..1849,1859..1864, 1871..1879,1883..1888,1898..1900,1907..1909) /gene="NFKB1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 1625..1738 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1742..1837 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2051..2140 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2444..2671 /gene="NFKB1" /note="Death domain of the Nuclear Factor-KappaB1 precursor protein p105; Region: Death_NFkB1_p105; cd08797" /db_xref="CDD:260063" ORIGIN
tctctcgccccgacccacacccgggcccgctcgggctccggccggccgccgcctcttccttctccagcttttaggcctgcgccgcccgggagggagagcccacccgcgacagaggccgaacgctgactcgccacccggcttcagaatggcagaagatgatccatatttgggaaggcctgaacaaatgtttcatttggatcctttgactcatacaatatttaatccagaagtatttcaaccacagatggcactgccaacagcagatggcccataccttcaaatattagagcaacctaaacagagaggatttcgtttccgttacgtatgtgaaggcccatcccatggtggactacctggtgcctctagcgaaaagaacaagaagtcttaccctcaggtcaaaatctgcaactatgtgggaccagcaaaggttattgttcagttggtcacaaatggaaaaaatacccacctgcatgcccacagcctggtgggaaaacactgtgaggatgggatctgcactgtaactgctggacccaaggacatggtggtcggctttgcaaacttgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcgcgaatgacagaggcgtgtataaggggctacaatcccggactcttggtgcaccctgaccttgtgtatttgcaagcagaaggtggaggggaccggcagctgggagatcgggaaaaagagctaatccgccaggcagctctgcagcagaccaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttccggatagcactggcagcttcacaaggcgcctggaacccgtggtatcagacgccatctatgacagtaaagcccccaatgcatccaacttgaaaattgtaagaatggacaggacagctggatgtgtgactggaggagaggaaatttatcttctctgtgacaaagttcagaaagatgacatccagattcgattttacgaagaagaggaaaatggtggagtctgggaaggatttggagatttttcccctacagatgttcatagacaatttgccatcgtcttcaaaaccccaaagtataaagatgttaatattacaaaaccagcttctgtgtttgtccagcttcggaggaaatctgacttggaaactagtgaaccaaaacctttcctttactatcctgaaataaaagggtatagcttcccacactatggatttcctacttatggagggattaccttccatcctggaactactaaatctaatgctgggatgaaacatggaactatggacagtgaatctaaaaaggaccctgaaggttgtgacaaaagtgatgacagagtcactgtaaacctctttggaaaagtcactgaaaccacagagcaggatcaggagcccagcaaggccatcgatgggaatggtgaggtcgctctaacgtatgcaacagaaaccaaagaagagagtgctggggttcaggataacctctttctagagaaggctatgcagcttgcaaagaggcatgccaatgcccttttcgactatgcagtgacaggagacgtgaagatgttgctggctgtccagcgccatctcactgctgtgcaggatgagaatggggacagtgtcttacacctagcaatcatccaccttcattctcaacttgtgagggatctactagaagtcacatctggtttgatttctgatgacattatcaacatgagaaatgacctgtaccagacacccttgcacttggcagtgatcactaagcaggaagatgtggtggaggatttgctgagggccggggctgacctgagccttctggaccgctttggtaactctgttttgcacctagctgccaaagaaggaaatgataaagttctcagtatcttactcaagcacaaaaaggcagcactacttcttgaccaccccaacggggacggtctgaatgccattcatctagccatgatgagcaatagcctgccatgtctgctgctgctggtggccgctggggccaacgtcaatgctcaggagcaaaagtctggacgcacagccctgcacctggctgtggagcacgacaacatctcattggcaggctgcctgctcctggagggtgatgcccatgtggacagtactacctacgatggaactacacccctgcatatagcagctgggagagggtccaccaggctggccgctcttctcaaagcagcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaatgcaggagaggatgaaggagttgtacctggaaccacacctctagatatggccaccagctggcaggtatttgacatattaaatgggaaaccatatgagccagagtttacatctgatgatttactggcacaaggagacatgaaacagctgactgaagatgtgaagctgcagctctataagttgctagaaattcctgatccagacaaaaactgggctactttggcacagaaattaggtctggggatacttaataatgccttccggctgagtcctgctccttccaaaacacttatggacaactatgaggtctctggggggacggtcagagagctggtggaggccctgagacaaatgggctacaccgaagcagttgaagtgatccaggcagcctccagcccagtgaagaccacctcgcaggcccactcactgcctctctcacctgcatccacaaggcagcaaatagatgagctccgagacagcgacagtgtctgcgacagcggcgtggagacgtccttccacaggctcagcttcaccgagtctctgaccagtggtggctcactgctaactctcaacaaaatgccccatgattatgggcaggaaagacctctagaaggcaaaatttagcctgctgacaatttcccacaccatgtaaaccaaagccctgaaattccactgcattgtccacaagaagaaagctgaagcgcatccaaaggtgctcagagagctggcctgccagaatcattctcgatttaacgcaaggccttttcaacttggcttcctttcttggttcataaatgaattttagtttggttcacttacagatagtatctagcaatcatagcactggctgagcggatgcatctggggatgaggctgcttactgagctttgccggccgctgctggatcacagctgctttctgttgtcgttgttgtccctctgctacgttcctgttgtcattaaagtatcactggccccacctggcattccttctgaccacccacagcatcgttttgcattcaaattaagcgttaagaaaagggatattttaaaatgaaagtcacttgatgtgcaatttaaaaaaaaggcgtattactttttctaatgtggttatttctcggatttaaaaaaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]