GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-05 08:58:51, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_032261612            3418 bp    mRNA    linear   PRI 02-FEB-2020
DEFINITION  PREDICTED: Sapajus apella nuclear factor kappa B subunit 1 (NFKB1),
            transcript variant X3, mRNA.
ACCESSION   XM_032261612
VERSION     XM_032261612.1
DBLINK      BioProject: PRJNA599380
KEYWORDS    RefSeq.
SOURCE      Sapajus apella (tufted capuchin)
  ORGANISM  Sapajus apella
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Platyrrhini; Cebidae; Cebinae; Sapajus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_022437064.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Sapajus apella Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3418
                     /organism="Sapajus apella"
                     /mol_type="mRNA"
                     /isolate="SASKATOON/1434"
                     /db_xref="taxon:9515"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
     gene            1..3418
                     /gene="NFKB1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 269 ESTs, 1 Protein, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 22 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:116538998"
     CDS             146..2908
                     /gene="NFKB1"
                     /codon_start=1
                     /product="nuclear factor NF-kappa-B p105 subunit isoform
                     X3"
                     /protein_id="XP_032117503.1"
                     /db_xref="GeneID:116538998"
                     /translation="
MAEDDPYLGRPEQMFHLDPLTHTIFNPEVFQPQMALPTADGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNTHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLVYLQAEGGGDRQLGDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKGYSFPHYGFPTYGGITFHPGTTKSNAGMKHGTMDSESKKDPEGCDKSDDRVTVNLFGKVTETTEQDQEPSKAIDGNGEVALTYATETKEESAGVQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHSQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQEDVVEDLLRAGADLSLLDRFGNSVLHLAAKEGNDKVLSILLKHKKAALLLDHPNGDGLNAIHLAMMSNSLPCLLLLVAAGANVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWENAGEDEGVVPGTTPLDMATSWQVFDILNGKPYEPEFTSDDLLAQGDMKQLTEDVKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVRELVEALRQMGYTEAVEVIQAASSPVKTTSQAHSLPLSPASTRQQIDELRDSDSVCDSGVETSFHRLSFTESLTSGGSLLTLNKMPHDYGQERPLEGKI"
     misc_feature    269..874
                     /gene="NFKB1"
                     /note="N-terminal sub-domain of the Rel homology domain
                     (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region:
                     RHD-n_NFkB1; cd07935"
                     /db_xref="CDD:143651"
     misc_feature    order(311..313,317..322,326..331,338..349,572..574,
                     578..583,872..874)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143651"
     misc_feature    893..1198
                     /gene="NFKB1"
                     /note="IPT domain of the transcription factor NFkappaB and
                     related transcription factors. NFkappaB is considered a
                     central regulator of stress responses, activated by
                     different stressful conditions, including physical stress,
                     oxidative stress, and exposure to...; Region:
                     IPT_NFkappaB; cd01177"
                     /db_xref="CDD:238582"
     misc_feature    order(896..898,902..910,914..922,1040..1048,1085..1087,
                     1121..1123,1178..1180,1187..1189,1193..1195)
                     /gene="NFKB1"
                     /note="ankyrin protein binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238582"
     misc_feature    order(902..907,911..913,950..952,956..958,962..964,
                     1061..1066,1073..1075,1079..1081)
                     /gene="NFKB1"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238582"
     misc_feature    order(965..967,971..973,1064..1069)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238582"
     misc_feature    1493..2275
                     /gene="NFKB1"
                     /note="Ankyrin repeat [Signal transduction mechanisms];
                     Region: ANKYR; COG0666"
                     /db_xref="CDD:440430"
     misc_feature    order(1625..1627,1631..1633,1643..1648,1655..1663,
                     1667..1672,1682..1684,1691..1693,1736..1738,1742..1744,
                     1748..1750,1760..1765,1772..1780,1784..1789,1799..1801,
                     1808..1810,1835..1837,1841..1843,1847..1849,1859..1864,
                     1871..1879,1883..1888,1898..1900,1907..1909)
                     /gene="NFKB1"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    1625..1738
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1742..1837
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2051..2140
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2444..2671
                     /gene="NFKB1"
                     /note="Death domain of the Nuclear Factor-KappaB1
                     precursor protein p105; Region: Death_NFkB1_p105; cd08797"
                     /db_xref="CDD:260063"
ORIGIN      
tctctcgccccgacccacacccgggcccgctcgggctccggccggccgccgcctcttccttctccagcttttaggcctgcgccgcccgggagggagagcccacccgcgacagaggccgaacgctgactcgccacccggcttcagaatggcagaagatgatccatatttgggaaggcctgaacaaatgtttcatttggatcctttgactcatacaatatttaatccagaagtatttcaaccacagatggcactgccaacagcagatggcccataccttcaaatattagagcaacctaaacagagaggatttcgtttccgttacgtatgtgaaggcccatcccatggtggactacctggtgcctctagcgaaaagaacaagaagtcttaccctcaggtcaaaatctgcaactatgtgggaccagcaaaggttattgttcagttggtcacaaatggaaaaaatacccacctgcatgcccacagcctggtgggaaaacactgtgaggatgggatctgcactgtaactgctggacccaaggacatggtggtcggctttgcaaacttgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcgcgaatgacagaggcgtgtataaggggctacaatcccggactcttggtgcaccctgaccttgtgtatttgcaagcagaaggtggaggggaccggcagctgggagatcgggaaaaagagctaatccgccaggcagctctgcagcagaccaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttccggatagcactggcagcttcacaaggcgcctggaacccgtggtatcagacgccatctatgacagtaaagcccccaatgcatccaacttgaaaattgtaagaatggacaggacagctggatgtgtgactggaggagaggaaatttatcttctctgtgacaaagttcagaaagatgacatccagattcgattttacgaagaagaggaaaatggtggagtctgggaaggatttggagatttttcccctacagatgttcatagacaatttgccatcgtcttcaaaaccccaaagtataaagatgttaatattacaaaaccagcttctgtgtttgtccagcttcggaggaaatctgacttggaaactagtgaaccaaaacctttcctttactatcctgaaataaaagggtatagcttcccacactatggatttcctacttatggagggattaccttccatcctggaactactaaatctaatgctgggatgaaacatggaactatggacagtgaatctaaaaaggaccctgaaggttgtgacaaaagtgatgacagagtcactgtaaacctctttggaaaagtcactgaaaccacagagcaggatcaggagcccagcaaggccatcgatgggaatggtgaggtcgctctaacgtatgcaacagaaaccaaagaagagagtgctggggttcaggataacctctttctagagaaggctatgcagcttgcaaagaggcatgccaatgcccttttcgactatgcagtgacaggagacgtgaagatgttgctggctgtccagcgccatctcactgctgtgcaggatgagaatggggacagtgtcttacacctagcaatcatccaccttcattctcaacttgtgagggatctactagaagtcacatctggtttgatttctgatgacattatcaacatgagaaatgacctgtaccagacacccttgcacttggcagtgatcactaagcaggaagatgtggtggaggatttgctgagggccggggctgacctgagccttctggaccgctttggtaactctgttttgcacctagctgccaaagaaggaaatgataaagttctcagtatcttactcaagcacaaaaaggcagcactacttcttgaccaccccaacggggacggtctgaatgccattcatctagccatgatgagcaatagcctgccatgtctgctgctgctggtggccgctggggccaacgtcaatgctcaggagcaaaagtctggacgcacagccctgcacctggctgtggagcacgacaacatctcattggcaggctgcctgctcctggagggtgatgcccatgtggacagtactacctacgatggaactacacccctgcatatagcagctgggagagggtccaccaggctggccgctcttctcaaagcagcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaatgcaggagaggatgaaggagttgtacctggaaccacacctctagatatggccaccagctggcaggtatttgacatattaaatgggaaaccatatgagccagagtttacatctgatgatttactggcacaaggagacatgaaacagctgactgaagatgtgaagctgcagctctataagttgctagaaattcctgatccagacaaaaactgggctactttggcacagaaattaggtctggggatacttaataatgccttccggctgagtcctgctccttccaaaacacttatggacaactatgaggtctctggggggacggtcagagagctggtggaggccctgagacaaatgggctacaccgaagcagttgaagtgatccaggcagcctccagcccagtgaagaccacctcgcaggcccactcactgcctctctcacctgcatccacaaggcagcaaatagatgagctccgagacagcgacagtgtctgcgacagcggcgtggagacgtccttccacaggctcagcttcaccgagtctctgaccagtggtggctcactgctaactctcaacaaaatgccccatgattatgggcaggaaagacctctagaaggcaaaatttagcctgctgacaatttcccacaccatgtaaaccaaagccctgaaattccactgcattgtccacaagaagaaagctgaagcgcatccaaaggtgctcagagagctggcctgccagaatcattctcgatttaacgcaaggccttttcaacttggcttcctttcttggttcataaatgaattttagtttggttcacttacagatagtatctagcaatcatagcactggctgagcggatgcatctggggatgaggctgcttactgagctttgccggccgctgctggatcacagctgctttctgttgtcgttgttgtccctctgctacgttcctgttgtcattaaagtatcactggccccacctggcattccttctgaccacccacagcatcgttttgcattcaaattaagcgttaagaaaagggatattttaaaatgaaagtcacttgatgtgcaatttaaaaaaaaggcgtattactttttctaatgtggttatttctcggatttaaaaaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]